AAAS

AAAS siRNA

20-abx906236
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AAAS antibody

70R-15492 50 ul
EUR 435.00
Description: Rabbit polyclonal AAAS antibody

AAAS Antibody

ABD9182 100 ug
EUR 438.00

AAAS Antibody

1-CSB-PA001010GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

AAAS Antibody

1-CSB-PA004655
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

AAAS Antibody

1-CSB-PA211579
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

AAAS Antibody

1-CSB-PA798772
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

AAAS Antibody

DF9182 200ul
EUR 304.00
Description: AAAS Antibody detects endogenous levels of total AAAS.

AAAS Antibody

1-CSB-PA878867ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AAAS. Recognizes AAAS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

AAAS antibody

38905-100ul 100ul
EUR 252.00

AAAS Antibody

36054-100ul 100ul
EUR 252.00

pOTB7-AAAS

PVT18761 2 ug
EUR 231.00

AAAS Polyclonal Antibody

E-AB-33314-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Adracalin (AAAS) is expressed in both neuroendocrine and cerebral structures and may functio
  • Show more
Description: Rabbit antibody against Human,Rat AAAS for WB,ELISA applications.

AAAS Polyclonal Antibody

E-AB-33314-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Adracalin (AAAS) is expressed in both neuroendocrine and cerebral structures and may functio
  • Show more
Description: Rabbit antibody against Human,Rat AAAS for WB,ELISA applications.

AAAS Polyclonal Antibody

E-AB-33314-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Adracalin (AAAS) is expressed in both neuroendocrine and cerebral structures and may functio
  • Show more
Description: Rabbit antibody against Human,Rat AAAS for WB,ELISA applications.

Aladin (AAAS) Antibody

20-abx322239
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

AAAS Rabbit pAb

A6427-100ul 100 ul
EUR 308.00

AAAS Rabbit pAb

A6427-200ul 200 ul
EUR 459.00

AAAS Rabbit pAb

A6427-20ul 20 ul
EUR 183.00

AAAS Rabbit pAb

A6427-50ul 50 ul
EUR 223.00

AAAS Blocking Peptide

DF9182-BP 1mg
EUR 195.00

Aladin (AAAS) Antibody

20-abx004920
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

AAAS Polyclonal Antibody

E-AB-10745-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be in
  • Show more
Description: Rabbit antibody against Human,Mouse AAAS for WB,IHC,ELISA applications.

AAAS Polyclonal Antibody

E-AB-10745-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be in
  • Show more
Description: Rabbit antibody against Human,Mouse AAAS for WB,IHC,ELISA applications.

AAAS Polyclonal Antibody

E-AB-10745-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be in
  • Show more
Description: Rabbit antibody against Human,Mouse AAAS for WB,IHC,ELISA applications.

AAAS cloning plasmid

CSB-CL878867HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1641
  • Sequence: atgtgctctctggggttgttccctcctccaccgcctcggggtcaagtcaccctatatgagcacaataacgagctggtgacgggcagtagctatgagagcccgccccccgacttccggggccagtggatcaatcttcctgtcctacaactgacaaaggatcccctaaagacccctg
  • Show more
Description: A cloning plasmid for the AAAS gene.

Aladin (AAAS) Antibody

20-abx116774
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aladin (AAAS) Antibody

abx230275-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

AAAS Conjugated Antibody

C38905 100ul
EUR 397.00

AAAS Conjugated Antibody

C36054 100ul
EUR 397.00

Anti-AAAS antibody

STJ28510 100 µl
EUR 277.00
Description: The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be involved in normal development of the peripheral and central nervous system. The encoded protein is part of the nuclear pore complex and is anchored there by NDC1. Defects in this gene are a cause of achalasia-addisonianism-alacrima syndrome (AAAS), also called triple-A syndrome or Allgrove syndrome. Two transcript variants encoding different isoforms have been found for this gene.

Human AAAS shRNA Plasmid

20-abx955363
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AAAS shRNA Plasmid

20-abx981305
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AAAS ELISA KIT|Human

EF004559 96 Tests
EUR 689.00

AAAS Recombinant Protein (Human)

RP000013 100 ug Ask for price

AAAS Recombinant Protein (Rat)

RP188444 100 ug Ask for price

AAAS Recombinant Protein (Mouse)

RP113162 100 ug Ask for price

Mouse Aladin (AAAS) ELISA Kit

abx388488-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Human Aladin (AAAS) ELISA Kit

abx392195-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Polyclonal AAAS Antibody (C-Term)

AMM05524G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AAAS (C-Term). This antibody is tested and proven to work in the following applications:

Rat Aladin(AAAS) ELISA kit

E02A1113-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aladin(AAAS) ELISA kit

E02A1113-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aladin(AAAS) ELISA kit

E02A1113-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aladin(AAAS) ELISA kit

E01A1113-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aladin(AAAS) ELISA kit

E01A1113-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aladin(AAAS) ELISA kit

E01A1113-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aladin(AAAS) ELISA kit

E03A1113-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aladin(AAAS) ELISA kit

E03A1113-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aladin(AAAS) ELISA kit

E03A1113-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aladin(AAAS) ELISA kit

E06A1113-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Aladin(AAAS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.