ACTR8

ACTR8 siRNA
20-abx906665
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACTR8 Antibody
1-CSB-PA872523LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTR8. Recognizes ACTR8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

ACTR8 cloning plasmid
CSB-CL872523HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 990
  • Sequence: atgatactaatgaagatgggtttttcagggattgtggtccatcaggagtctgtgtgtgccacctatggaagtggcttaagcagcacgtgtattgtagacgttggggaccagaagacaagtgtatgctgtgtggaggatggggtgtctcatcggaatactcgcatcttttcctggaa
  • Show more
Description: A cloning plasmid for the ACTR8 gene.

ACTR8 Polyclonal Antibody
A57990 100 µg
EUR 570.55
Description: reagents widely cited

Mouse ACTR8 shRNA Plasmid
20-abx974666
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ACTR8 shRNA Plasmid
20-abx964228
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ACTR8 Antibody, FITC conjugated
1-CSB-PA872523LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTR8. Recognizes ACTR8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ACTR8 Antibody, HRP conjugated
1-CSB-PA872523LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTR8. Recognizes ACTR8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ACTR8 Antibody, Biotin conjugated
1-CSB-PA872523LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTR8. Recognizes ACTR8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ACTR8 Recombinant Protein (Human)
RP000439 100 ug Ask for price

ACTR8 Recombinant Protein (Mouse)
RP114101 100 ug Ask for price

ACTR8 Polyclonal Antibody, Biotin Conjugated
A57991 100 µg
EUR 570.55
Description: Ask the seller for details

ACTR8 Polyclonal Antibody, FITC Conjugated
A57992 100 µg
EUR 570.55
Description: The best epigenetics products

ACTR8 Polyclonal Antibody, HRP Conjugated
A57993 100 µg
EUR 570.55
Description: kits suitable for this type of research

ACTR8 ORF Vector (Human) (pORF)
ORF000147 1.0 ug DNA
EUR 95.00

Actr8 ORF Vector (Mouse) (pORF)
ORF038035 1.0 ug DNA
EUR 506.00

Actin-Related Protein 8 (ACTR8) Antibody
20-abx302684
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ACTR8 sgRNA CRISPR Lentivector set (Human)
K0039001 3 x 1.0 ug
EUR 339.00

Actr8 sgRNA CRISPR Lentivector set (Mouse)
K3048501 3 x 1.0 ug
EUR 339.00

ACTR8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0039002 1.0 ug DNA
EUR 154.00

ACTR8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0039003 1.0 ug DNA
EUR 154.00

ACTR8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0039004 1.0 ug DNA
EUR 154.00

Actr8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3048502 1.0 ug DNA
EUR 154.00

Actr8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3048503 1.0 ug DNA
EUR 154.00

Actr8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3048504 1.0 ug DNA
EUR 154.00

ACTR8 Protein Vector (Human) (pPB-C-His)
PV000585 500 ng
EUR 329.00

ACTR8 Protein Vector (Human) (pPB-N-His)
PV000586 500 ng
EUR 329.00

ACTR8 Protein Vector (Human) (pPM-C-HA)
PV000587 500 ng
EUR 329.00

ACTR8 Protein Vector (Human) (pPM-C-His)
PV000588 500 ng
EUR 329.00

ACTR8 Protein Vector (Mouse) (pPB-C-His)
PV152138 500 ng
EUR 603.00

ACTR8 Protein Vector (Mouse) (pPB-N-His)
PV152139 500 ng
EUR 603.00

ACTR8 Protein Vector (Mouse) (pPM-C-HA)
PV152140 500 ng
EUR 603.00

ACTR8 Protein Vector (Mouse) (pPM-C-His)
PV152141 500 ng
EUR 603.00

ACTR8 Protein Vector (Human) (pPB-His-MBP)
PV319638 500 ng
EUR 329.00

ACTR8 Protein Vector (Human) (pPB-His-GST)
PV319639 500 ng
EUR 329.00

Actr8 3'UTR Luciferase Stable Cell Line
TU101335 1.0 ml Ask for price

Actr8 3'UTR GFP Stable Cell Line
TU151335 1.0 ml Ask for price

ACTR8 3'UTR Luciferase Stable Cell Line
TU000269 1.0 ml
EUR 1521.00

ACTR8 3'UTR GFP Stable Cell Line
TU050269 1.0 ml
EUR 1521.00

Mouse Actin related protein 8(ACTR8) ELISA kit
E03A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Actin related protein 8(ACTR8) ELISA kit
E03A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Actin related protein 8(ACTR8) ELISA kit
E03A0995-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Actin related protein 8(ACTR8) ELISA kit
E02A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Actin related protein 8(ACTR8) ELISA kit
E02A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Actin related protein 8(ACTR8) ELISA kit
E02A0995-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Actin related protein 8(ACTR8) ELISA kit
E04A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Actin related protein 8(ACTR8) ELISA kit
E04A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Actin related protein 8(ACTR8) ELISA kit
E04A0995-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin related protein 8(ACTR8) ELISA kit
E01A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin related protein 8(ACTR8) ELISA kit
E01A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.