ADRM1

Human Proteasomal ubiquitin receptor ADRM1 (ADRM1)

1-CSB-EP614959HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 58 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Proteasomal ubiquitin receptor ADRM1(ADRM1) expressed in E.coli

Proteasomal Ubiquitin Receptor ADRM1 (ADRM1) Antibody

20-abx003352
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasomal Ubiquitin Receptor ADRM1 (ADRM1) Antibody

abx031306-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Proteasomal Ubiquitin Receptor ADRM1 (ADRM1) Antibody

abx031306-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Proteasomal Ubiquitin Receptor ADRM1 (ADRM1) Antibody

abx036515-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Proteasomal Ubiquitin Receptor ADRM1 (ADRM1) Antibody

20-abx317868
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Proteasomal Ubiquitin Receptor ADRM1 (ADRM1) Antibody

abx230182-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

ADRM1 Antibody

1-CSB-PA001396GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ADRM1. Recognizes ADRM1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

ADRM1 Antibody

1-CSB-PA001396HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADRM1. Recognizes ADRM1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

ADRM1 antibody

70R-9755 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal ADRM1 antibody

ADRM1 siRNA

20-abx900209
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADRM1 siRNA

20-abx906924
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADRM1 siRNA

20-abx906925
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADRM1 Protein

20-abx262513
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ADRM1 Antibody

DF12142 200ul
EUR 304.00
Description: ADRM1 antibody detects endogenous levels of ADRM1.

ADRM1 antibody

70R-15612 50 ul
EUR 435.00
Description: Rabbit polyclonal ADRM1 antibody

ADRM1 Antibody

47298-100ul 100ul
EUR 252.00

anti-ADRM1

YF-PA25719 50 ul
EUR 334.00
Description: Mouse polyclonal to ADRM1

Proteasomal Ubiquitin Receptor ADRM1 (ADRM1) Antibody (HRP)

20-abx314038
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Proteasomal Ubiquitin Receptor ADRM1 (ADRM1) Antibody (FITC)

20-abx314039
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Proteasomal Ubiquitin Receptor ADRM1 (ADRM1) Antibody (Biotin)

20-abx314040
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat Proteasomal ubiquitin receptor ADRM1 (ADRM1) ELISA Kit

abx390937-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Human Proteasomal ubiquitin receptor ADRM1 (ADRM1) ELISA Kit

20-abx385644
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Proteasomal ubiquitin receptor ADRM1 (ADRM1) ELISA Kit

abx388526-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Bovine Proteasomal ubiquitin receptor ADRM1, ADRM1 ELISA KIT

ELI-34821b 96 Tests
EUR 928.00

Chicken Proteasomal ubiquitin receptor ADRM1, ADRM1 ELISA KIT

ELI-24565c 96 Tests
EUR 928.00

Mouse Proteasomal ubiquitin receptor ADRM1, Adrm1 ELISA KIT

ELI-11602m 96 Tests
EUR 865.00

Human Proteasomal ubiquitin receptor ADRM1, ADRM1 ELISA KIT

ELI-24397h 96 Tests
EUR 824.00

Polyclonal ADRM1 Antibody

APR14856G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADRM1 . This antibody is tested and proven to work in the following applications:

ADRM1 Conjugated Antibody

C47298 100ul
EUR 397.00

ADRM1 cloning plasmid

CSB-CL614959HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1224
  • Sequence: atgacgacctcaggcgcgctctttccaagcctggtgccaggctctcggggcgcctccaacaagtacttggtggagtttcgggcgggaaagatgtccctgaaggggaccaccgtgactccggataagcggaaagggctggtgtacattcagcagacggacgactcgcttattcact
  • Show more
Description: A cloning plasmid for the ADRM1 gene.

ADRM1 Rabbit pAb

A4481-100ul 100 ul
EUR 308.00

ADRM1 Rabbit pAb

A4481-200ul 200 ul
EUR 459.00

ADRM1 Rabbit pAb

A4481-20ul 20 ul
EUR 183.00

ADRM1 Rabbit pAb

A4481-50ul 50 ul
EUR 223.00

ADRM1 Blocking Peptide

DF12142-BP 1mg
EUR 195.00

anti- ADRM1 antibody

FNab00182 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • IP: 1:200-1:2000
  • Immunogen: adhesion regulating molecule 1
  • Uniprot ID: Q16186
  • Gene ID: 11047
  • Research Area: Epigenetics
Description: Antibody raised against ADRM1

anti-ADRM1 (3C6)

LF-MA10010 100 ug
EUR 363.00
Description: Mouse monoclonal to ADRM1

Anti-ADRM1 antibody

PAab00182 100 ug
EUR 355.00

Anti-ADRM1 antibody

STJ22536 100 µl
EUR 277.00
Description: This gene encodes a member of the adhesion regulating molecule 1 protein family. The encoded protein is a component of the proteasome where it acts as a ubiquitin receptor and recruits the deubiquitinating enzyme, ubiquitin carboxyl-terminal hydrolase L5. Increased levels of the encoded protein are associated with increased cell adhesion, which is likely an indirect effect of this intracellular protein. Dysregulation of this gene has been implicated in carcinogenesis. Alternative splicing results in multiple transcript variants.

Anti-ADRM1 (3D11)

YF-MA17574 100 ug
EUR 363.00
Description: Mouse monoclonal to ADRM1

Adrm1 ELISA Kit| Mouse Proteasomal ubiquitin receptor ADRM1 ELI

EF014151 96 Tests
EUR 689.00

Adrm1 ELISA Kit| Rat Proteasomal ubiquitin receptor ADRM1 ELISA

EF018290 96 Tests
EUR 689.00

ADRM1 ELISA Kit| Bovine Proteasomal ubiquitin receptor ADRM1 EL

EF011094 96 Tests
EUR 689.00

ADRM1 ELISA Kit| chicken Proteasomal ubiquitin receptor ADRM1 E

EF012195 96 Tests
EUR 689.00

Rat ADRM1 shRNA Plasmid

20-abx986395
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ADRM1 shRNA Plasmid

20-abx974772
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADRM1 Antibody, HRP conjugated

1-CSB-PA001396HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADRM1. Recognizes ADRM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADRM1 Antibody, FITC conjugated

1-CSB-PA001396HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADRM1. Recognizes ADRM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADRM1 Antibody, Biotin conjugated

1-CSB-PA001396HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADRM1. Recognizes ADRM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA