Human Arrestin Beta 2 (ARRb2) ELISA Kit

DLR-ARRb2-Hu-96T 96T
EUR 647
  • Should the Human Arrestin Beta 2 (ARRb2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Arrestin Beta 2 (ARRb2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Arrestin Beta 2 (ARRb2) ELISA Kit

RD-ARRb2-Hu-48Tests 48 Tests
EUR 500

Human Arrestin Beta 2 (ARRb2) ELISA Kit

RD-ARRb2-Hu-96Tests 96 Tests
EUR 692

Human Arrestin Beta 2 (ARRb2) ELISA Kit

RDR-ARRb2-Hu-48Tests 48 Tests
EUR 522

Human Arrestin Beta 2 (ARRb2) ELISA Kit

RDR-ARRb2-Hu-96Tests 96 Tests
EUR 724

Arrb2/ Rat Arrb2 ELISA Kit

ELI-06412r 96 Tests
EUR 886

ARRB2 Antibody

ABD6305 100 ug
EUR 438

ARRB2 antibody

38209-100ul 100ul
EUR 252

ARRB2 antibody

70R-15849 50 ul
EUR 435
Description: Rabbit polyclonal ARRB2 antibody

ARRB2 Antibody

DF6305 200ul
EUR 304
Description: ARRB2 Antibody detects endogenous levels of total ARRB2.

ARRB2 Antibody

1-CSB-PA002135GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ARRB2. Recognizes ARRB2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

ARRB2 Antibody

1-CSB-PA002135LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARRB2. Recognizes ARRB2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:50-1:200

ARRB2 Conjugated Antibody

C38209 100ul
EUR 397

ARRB2 Rabbit pAb

A1171-100ul 100 ul
EUR 308

ARRB2 Rabbit pAb

A1171-200ul 200 ul
EUR 459

ARRB2 Rabbit pAb

A1171-20ul 20 ul
EUR 183

ARRB2 Rabbit pAb

A1171-50ul 50 ul
EUR 223

ARRB2 Rabbit pAb

A13278-100ul 100 ul
EUR 308

ARRB2 Rabbit pAb

A13278-200ul 200 ul
EUR 459

ARRB2 Rabbit pAb

A13278-20ul 20 ul
EUR 183

ARRB2 Rabbit pAb

A13278-50ul 50 ul
EUR 223

ARRB2 Rabbit pAb

A19406-100ul 100 ul Ask for price

ARRB2 Rabbit pAb

A19406-200ul 200 ul Ask for price

ARRB2 Rabbit pAb

A19406-20ul 20 ul Ask for price

ARRB2 Rabbit pAb

A19406-50ul 50 ul
EUR 308

ARRB2 Blocking Peptide

DF6305-BP 1mg
EUR 195

ARRB2 cloning plasmid

CSB-CL002135HU-10ug 10ug
EUR 454
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1230
  • Sequence: atgggggagaaacccgggaccagggtcttcaagaagtcgagccctaactgcaagctcaccgtgtacttgggcaagcgggacttcgtagatcacctggacaaagtggaccctgtagatggcgtggtgcttgtggaccctgactacctgaaggaccgcaaagtgtttgtgaccctca
  • Show more
Description: A cloning plasmid for the ARRB2 gene.

Anti-ARRB2 antibody

STJ11100604 50 µl
EUR 287
Description: Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-ARRB2 antibody

STJ22694 100 µl
EUR 277
Description: Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-ARRB2 antibody

STJ115243 100 µl
EUR 277
Description: Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Mouse ARRB2 shRNA Plasmid

20-abx981049
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ARRB2 shRNA Plasmid

20-abx984983
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ARRB2 ELISA Kit

ELA-E1994h 96 Tests
EUR 824

ARRB2 ELISA KIT|Human

EF006634 96 Tests
EUR 689

Human ARRB2 shRNA Plasmid

20-abx950297
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ARRB2 Antibody, HRP conjugated

1-CSB-PA002135LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARRB2. Recognizes ARRB2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ARRB2 Antibody, FITC conjugated

1-CSB-PA002135LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARRB2. Recognizes ARRB2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ARRB2 Antibody, Biotin conjugated

1-CSB-PA002135LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARRB2. Recognizes ARRB2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ARRB2 Recombinant Protein (Human)

RP001963 100 ug Ask for price

ARRB2 Recombinant Protein (Rat)

RP191036 100 ug Ask for price

ARRB2 Recombinant Protein (Mouse)

RP117323 100 ug Ask for price

Polyclonal ARRB2 Antibody (C-Term)

APR11469G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARRB2 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal ARRB2 antibody - middle region

APR11472G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARRB2 - middle region. This antibody is tested and proven to work in the following applications:

Arrestin Beta 2 (ARRB2) Antibody

20-abx111071
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Arrestin Beta 2 (ARRB2) Antibody

20-abx000571
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Arrestin Beta 2 (ARRB2) Antibody

20-abx001085
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Arrestin Beta 2 (ARRB2) Antibody

20-abx148349
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Arrestin Beta 2 (ARRb2) Antibody

20-abx101459
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Arrestin Beta 2 (ARRB2) Antibody

20-abx318855
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Arrestin Beta 2 (ARRB2) Antibody

abx431662-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.