BCL10

BCL10 Antibody
1-CSB-PA002608ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against BCL10. Recognizes BCL10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

BCL10 Antibody
1-CSB-PA002608GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against BCL10. Recognizes BCL10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

BCL10 Antibody
1-CSB-PA002608HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BCL10. Recognizes BCL10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

BCL10 Antibody
1-CSB-PA057007
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BCL10. Recognizes BCL10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

BCL10 Antibody
1-CSB-PA010575
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BCL10. Recognizes BCL10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

BCL10 Antibody
1-CSB-PA390581
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BCL10. Recognizes BCL10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BCL10 antibody
10R-1961 100 ul
EUR 349.00
Description: Mouse monoclonal BCL10 antibody

BCL10 antibody
10R-3426 100 ul
EUR 691.00
Description: Mouse monoclonal BCL10 antibody

BCL10 Antibody
32162-100ul 100ul
EUR 252.00

BCL10 antibody
70R-33789 100 ug
EUR 327.00
Description: Rabbit polyclonal BCL10 antibody

BCL10 antibody
70R-BR022 100 ug
EUR 300.00
Description: Affinity purified Rabbit polyclonal BCL10 antibody

BCL10 siRNA
20-abx900609
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BCL10 Protein
20-abx263205
  • EUR 230.00
  • EUR 1483.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

BCL10 siRNA
20-abx908965
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BCL10 siRNA
20-abx908966
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BCL10 Antibody
DF3606 200ul
EUR 304.00
Description: BCL10 Antibody detects endogenous levels of total BCL10.

BCL10 Antibody
DF6246 200ul
EUR 304.00
Description: BCL10 Antibody detects endogenous levels of total BCL10.

BCL10 Antibody
ABD3606 100 ug
EUR 438.00

BCL10 Antibody
ABD6246 100 ug
EUR 438.00

BCL10 antibody
70R-15973 50 ul
EUR 435.00
Description: Rabbit polyclonal BCL10 antibody

BCL10 antibody
70R-14043 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal BCL10 antibody

Bcl10 Antibody
49095-100ul 100ul
EUR 333.00

Bcl10 Antibody
49095-50ul 50ul
EUR 239.00

Bcl10 Conjugated Antibody
C49095 100ul
EUR 397.00

BCL10 Conjugated Antibody
C32162 100ul
EUR 397.00

BCL10 cloning plasmid
CSB-CL002608HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 702
  • Sequence: atggagcccaccgcaccgtccctcaccgaggaggacctcactgaagtgaagaaggacgccttagaaaatttacgtgtatacctgtgtgagaaaatcatagctgagagacattttgatcatctacgtgcaaaaaaaatactcagtagagaagacactgaagaaatttcttgtcgaac
  • Show more
Description: A cloning plasmid for the BCL10 gene.

Bcl10 Rabbit mAb
A4520-100ul 100 ul
EUR 410.00

Bcl10 Rabbit mAb
A4520-200ul 200 ul
EUR 571.00

Bcl10 Rabbit mAb
A4520-20ul 20 ul
EUR 221.00

Bcl10 Rabbit mAb
A4520-50ul 50 ul
EUR 287.00

BCL10 Polyclonal Antibody
A55074 100 µg
EUR 570.55
Description: Ask the seller for details

BCL10 Polyclonal Antibody
E-AB-10997-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymph
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat BCL10 for WB,IHC,ELISA applications.

BCL10 Polyclonal Antibody
E-AB-10997-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymph
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat BCL10 for WB,IHC,ELISA applications.

BCL10 Polyclonal Antibody
E-AB-10997-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymph
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat BCL10 for WB,IHC,ELISA applications.

BCL10 Blocking Peptide
DF3606-BP 1mg
EUR 195.00

BCL10 Blocking Peptide
DF6246-BP 1mg
EUR 195.00

BCL10 Rabbit pAb
A0191-100ul 100 ul
EUR 308.00

BCL10 Rabbit pAb
A0191-200ul 200 ul
EUR 459.00

BCL10 Rabbit pAb
A0191-20ul 20 ul Ask for price

BCL10 Rabbit pAb
A0191-50ul 50 ul Ask for price

anti- BCL10 antibody
FNab00835 100µg
EUR 505.25
  • Immunogen: B-cell CLL/lymphoma 10
  • Uniprot ID: O95999
  • Gene ID: 8915
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against BCL10

anti- BCL10 antibody
FNab00836 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: B-cell CLL/lymphoma 10
  • Uniprot ID: O95999
  • Gene ID: 8915
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against BCL10

Anti-Bcl10 Antibody
PA1504 100ug/vial
EUR 294.00

Anti-Bcl10 Antibody
PB9525 100ug/vial
EUR 294.00

Anti-BCL10 antibody
PAab00835 100 ug
EUR 355.00

Anti-BCL10 antibody
PAab00836 100 ug
EUR 355.00

pCAGGS-Myc-BCL10
PVT19068 2 ug
EUR 258.00

Anti-BCL10 antibody
STJ110932 100 µl
EUR 277.00
Description: This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymphoma. The protein encoded by this gene contains a caspase recruitment domain (CARD), and has been shown to induce apoptosis and to activate NF-kappaB. This protein is reported to interact with other CARD domain containing proteins including CARD9, 10, 11 and 14, which are thought to function as upstream regulators in NF-kappaB signaling. This protein is found to form a complex with MALT1, a protein encoded by another gene known to be translocated in MALT lymphoma. MALT1 and this protein are thought to synergize in the activation of NF-kappaB, and the deregulation of either of them may contribute to the same pathogenetic process that leads to the malignancy. Alternative splicing results in multiple transcript variants.

Anti-BCL10 antibody
STJ22772 100 µl
EUR 413.00
Description: This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymphoma. The protein encoded by this gene contains a caspase recruitment domain (CARD), and has been shown to induce apoptosis and to activate NF-kappaB. This protein is reported to interact with other CARD domain containing proteins including CARD9, 10, 11 and 14, which are thought to function as upstream regulators in NF-kappaB signaling. This protein is found to form a complex with MALT1, a protein encoded by another gene known to be translocated in MALT lymphoma. MALT1 and this protein are thought to synergize in the activation of NF-kappaB, and the deregulation of either of them may contribute to the same pathogenetic process that leads to the malignancy. Alternative splicing results in multiple transcript variants.

Rat BCL10 shRNA Plasmid
20-abx986765
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.