  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BCL10 Protein

  • EUR 230.00
  • EUR 1483.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

BCL10 antibody

70R-33789 100 ug
EUR 327
Description: Rabbit polyclonal BCL10 antibody

BCL10 antibody

70R-BR022 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal BCL10 antibody

BCL10 Antibody

ABD3606 100 ug
EUR 438

BCL10 Antibody

ABD6246 100 ug
EUR 438

Bcl10 Antibody

49095-100ul 100ul
EUR 333

Bcl10 Antibody

49095-50ul 50ul
EUR 239

BCL10 Antibody

32162-100ul 100ul
EUR 252

BCL10 antibody

10R-1961 100 ul
EUR 349
Description: Mouse monoclonal BCL10 antibody

BCL10 antibody

10R-3426 100 ul
EUR 691
Description: Mouse monoclonal BCL10 antibody

BCL10 antibody

70R-14043 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal BCL10 antibody

BCL10 antibody

70R-15973 50 ul
EUR 435
Description: Rabbit polyclonal BCL10 antibody

BCL10 Antibody

DF6246 200ul
EUR 304
Description: BCL10 Antibody detects endogenous levels of total BCL10.

BCL10 Antibody

DF3606 200ul
EUR 304
Description: BCL10 Antibody detects endogenous levels of total BCL10.

BCL10 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against BCL10. Recognizes BCL10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

BCL10 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against BCL10. Recognizes BCL10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

BCL10 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BCL10. Recognizes BCL10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

BCL10 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BCL10. Recognizes BCL10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

BCL10 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BCL10. Recognizes BCL10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BCL10 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BCL10. Recognizes BCL10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

Bcl10 Conjugated Antibody

C49095 100ul
EUR 397

BCL10 Conjugated Antibody

C32162 100ul
EUR 397

BCL10 cloning plasmid

CSB-CL002608HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 702
  • Sequence: atggagcccaccgcaccgtccctcaccgaggaggacctcactgaagtgaagaaggacgccttagaaaatttacgtgtatacctgtgtgagaaaatcatagctgagagacattttgatcatctacgtgcaaaaaaaatactcagtagagaagacactgaagaaatttcttgtcgaac
  • Show more
Description: A cloning plasmid for the BCL10 gene.

anti- BCL10 antibody

FNab00835 100µg
EUR 505.25
  • Immunogen: B-cell CLL/lymphoma 10
  • Uniprot ID: O95999
  • Gene ID: 8915
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against BCL10

anti- BCL10 antibody

FNab00836 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: B-cell CLL/lymphoma 10
  • Uniprot ID: O95999
  • Gene ID: 8915
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against BCL10

BCL10 Rabbit pAb

A0191-100ul 100 ul
EUR 308

BCL10 Rabbit pAb

A0191-200ul 200 ul
EUR 459

BCL10 Rabbit pAb

A0191-20ul 20 ul Ask for price

BCL10 Rabbit pAb

A0191-50ul 50 ul Ask for price

BCL10 Polyclonal Antibody

A55074 100 µg
EUR 570.55
Description: Ask the seller for details

Bcl10 Rabbit mAb

A4520-100ul 100 ul
EUR 410

Bcl10 Rabbit mAb

A4520-200ul 200 ul
EUR 571

Bcl10 Rabbit mAb

A4520-20ul 20 ul
EUR 221

Bcl10 Rabbit mAb

A4520-50ul 50 ul
EUR 287

BCL10 Blocking Peptide

DF6246-BP 1mg
EUR 195

BCL10 Blocking Peptide

DF3606-BP 1mg
EUR 195

Anti-Bcl10 Antibody

PB9525 100ug/vial
EUR 294

Anti-BCL10 antibody

PAab00835 100 ug
EUR 355

Anti-BCL10 antibody

PAab00836 100 ug
EUR 355

Anti-Bcl10 Antibody

PA1504 100ug/vial
EUR 294


PVT19068 2 ug
EUR 258

Anti-BCL10 antibody

STJ110932 100 µl
EUR 277
Description: This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymphoma. The protein encoded by this gene contains a caspase recruitment domain (CARD), and has been shown to induce apoptosis and to activate NF-kappaB. This protein is reported to interact with other CARD domain containing proteins including CARD9, 10, 11 and 14, which are thought to function as upstream regulators in NF-kappaB signaling. This protein is found to form a complex with MALT1, a protein encoded by another gene known to be translocated in MALT lymphoma. MALT1 and this protein are thought to synergize in the activation of NF-kappaB, and the deregulation of either of them may contribute to the same pathogenetic process that leads to the malignancy. Alternative splicing results in multiple transcript variants.

Anti-BCL10 antibody

STJ22772 100 µl
EUR 413
Description: This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymphoma. The protein encoded by this gene contains a caspase recruitment domain (CARD), and has been shown to induce apoptosis and to activate NF-kappaB. This protein is reported to interact with other CARD domain containing proteins including CARD9, 10, 11 and 14, which are thought to function as upstream regulators in NF-kappaB signaling. This protein is found to form a complex with MALT1, a protein encoded by another gene known to be translocated in MALT lymphoma. MALT1 and this protein are thought to synergize in the activation of NF-kappaB, and the deregulation of either of them may contribute to the same pathogenetic process that leads to the malignancy. Alternative splicing results in multiple transcript variants.

Rat BCL10 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Bcl10 ELISA Kit

EHB0581 96Tests
EUR 521

Goat Bcl10 ELISA Kit

EGTB0581 96Tests
EUR 521

Canine Bcl10 ELISA Kit

ECB0581 96Tests
EUR 521