CCNE2

CCNE2 antibody
70R-10486	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal CCNE2 antibody

CCNE2 Antibody
36821-100ul	SAB	100ul	EUR 252

CCNE2 Antibody
1-CSB-PA004818ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CCNE2 Antibody
1-CSB-PA004818ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CCNE2 Antibody
1-CSB-PA004818GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CCNE2 Antibody
1-CSB-PA070235	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

CCNE2 Antibody
1-CSB-PA285746	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CCNE2 siRNA
20-abx910830	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCNE2 siRNA
20-abx910831	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCNE2 Rabbit pAb
A14086-100ul	Abclonal	100 ul	EUR 308

CCNE2 Rabbit pAb
A14086-200ul	Abclonal	200 ul	EUR 459

CCNE2 Rabbit pAb
A14086-20ul	Abclonal	20 ul	EUR 183

CCNE2 Rabbit pAb
A14086-50ul	Abclonal	50 ul	EUR 223

CCNE2 Blocking Peptide
33R-9328	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCNE2 antibody, catalog no. 70R-10486

CCNE2 Conjugated Antibody
C36821	SAB	100ul	EUR 397

CCNE2 cloning plasmid
CSB-CL004818HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 891 Sequence: atgtcaaaagaagtctggctaaacatgttaaaaaaggagagcagatatgttcatgacaaacattttgaagttctgcattctgacttggaaccacagatgaggtccatacttctagactggcttttagaggtatgtgaagtatacacacttcatagggaaacattttatcttgcaca Show more
Description: A cloning plasmid for the CCNE2 gene.

CCNE2 cloning plasmid
CSB-CL004818HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1125 Sequence: atgtcaagacgaagtagccgtttacaagctaagcagcagccccagcccagccagacggaatccccccaagaagcccagataatccaggccaagaagaggaaaactacccaggatgtcaaaaaaagaagagaggaggtcaccaagaaacatcagtatgaaattaggaattgttggc Show more
Description: A cloning plasmid for the CCNE2 gene.

CCNE2 Rabbit pAb
A4272-100ul	Abclonal	100 ul	EUR 308

CCNE2 Rabbit pAb
A4272-200ul	Abclonal	200 ul	EUR 459

CCNE2 Rabbit pAb
A4272-20ul	Abclonal	20 ul	EUR 183

CCNE2 Rabbit pAb
A4272-50ul	Abclonal	50 ul	EUR 223

CCNE2 Rabbit pAb
A7032-100ul	Abclonal	100 ul	EUR 308

CCNE2 Rabbit pAb
A7032-200ul	Abclonal	200 ul	EUR 459

CCNE2 Rabbit pAb
A7032-20ul	Abclonal	20 ul	EUR 183

CCNE2 Rabbit pAb
A7032-50ul	Abclonal	50 ul	EUR 223

Anti-CCNE2 antibody
STJ116021	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells.

Anti-CCNE2 antibody
STJ29112	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells.

Anti-CCNE2 antibody
STJ22953	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells.

Phospho-CCNE2 (T392) Antibody
1-CSB-PA070234	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CCNE2 (T392). Recognizes Phospho-CCNE2 (T392) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/10000

Cyclin E2 (CCNE2) Antibody
20-abx006418	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody
20-abx003169	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody
20-abx210917	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody
20-abx320783	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody
20-abx326211	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody
20-abx321826	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Human CCNE2 shRNA Plasmid
20-abx956041	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CCNE2 shRNA Plasmid
20-abx969527	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pECMV-3-FLAG-CCNE2
PVT13314	Lifescience Market	2 ug	EUR 599

CCNE2 Recombinant Protein (Human)
RP006175	ABM	100 ug	Ask for price

CCNE2 Recombinant Protein (Human)
RP006178	ABM	100 ug	Ask for price

CCNE2 Recombinant Protein (Rat)
RP193718	ABM	100 ug	Ask for price

CCNE2 Recombinant Protein (Mouse)
RP122177	ABM	100 ug	Ask for price

CCNE2 Recombinant Protein (Mouse)
RP122180	ABM	100 ug	Ask for price

Cyclin E2 (CCNE2) polyclonal antibody
ABP-PAB-10122	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

Ccne2 ORF Vector (Rat) (pORF)
ORF064574	ABM	1.0 ug DNA	EUR 506

h CCNE2 inducible lentiviral particles
LVP884	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: CCNE2 (cyclin E2), [alternative names: CYCE2]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_057749.2. It also contains a RFP-Blasticidin dual selection marker.

CCNE2 ORF Vector (Human) (pORF)
ORF002059	ABM	1.0 ug DNA	EUR 95

CCNE2 ORF Vector (Human) (pORF)
ORF002060	ABM	1.0 ug DNA	EUR 95

Ccne2 ORF Vector (Mouse) (pORF)
ORF040727	ABM	1.0 ug DNA	EUR 506

Ccne2 ORF Vector (Mouse) (pORF)
ORF040728	ABM	1.0 ug DNA	EUR 506

CCNE2 ELISA Kit (Mouse) (OKEI00583)
OKEI00583	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Essential for the control of the cell cycle at the late G1 and early S phase. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL

CCNE2 ELISA Kit (Rat) (OKEI00884)
OKEI00884	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL

Human Cyclin E2 (CCNE2) ELISA Kit
abx259514-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Cyclin E2 (CCNE2) ELISA Kit
abx353184-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Cyclin E2 (CCNE2) ELISA Kit
abx354051-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

CCNE2 sgRNA CRISPR Lentivector set (Human)
K0392701	ABM	3 x 1.0 ug	EUR 339

Ccne2 sgRNA CRISPR Lentivector set (Rat)
K6451901	ABM	3 x 1.0 ug	EUR 339

Ccne2 sgRNA CRISPR Lentivector set (Mouse)
K3766801	ABM	3 x 1.0 ug	EUR 339

Human Cyclin E2(CCNE2)ELISA Kit
QY-E00935	Qayee Biotechnology	96T	EUR 361

Rabbit Anti-CCNE2 monoclonal antibody, clone TE3146
DCABH-8531	Creative Diagnostics	100 ul	EUR 777

ELISA kit for Mouse CCNE2 (Cyclin-E2)
E-EL-M1316	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CCNE2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CCNE2. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CCNE2 (Cyclin-E2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat CCNE2 (Cyclin-E2)
E-EL-R1143	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CCNE2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CCNE2. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat CCNE2 (Cyclin-E2) in samples from Serum, Plasma, Cell supernatant

Cyclin E2 Phospho-Thr392 (CCNE2 pT392) Antibody
20-abx325115	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

CCNE2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0392702	ABM	1.0 ug DNA	EUR 154

CCNE2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0392703	ABM	1.0 ug DNA	EUR 154

CCNE2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0392704	ABM	1.0 ug DNA	EUR 154

Ccne2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6451902	ABM	1.0 ug DNA	EUR 154

Ccne2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6451903	ABM	1.0 ug DNA	EUR 154

Ccne2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6451904	ABM	1.0 ug DNA	EUR 154

Ccne2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3766802	ABM	1.0 ug DNA	EUR 154

Ccne2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3766803	ABM	1.0 ug DNA	EUR 154

Ccne2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3766804	ABM	1.0 ug DNA	EUR 154

CCNE2 Protein Vector (Mouse) (pPB-C-His)
PV162906	ABM	500 ng	EUR 603

CCNE2 Protein Vector (Mouse) (pPB-N-His)
PV162907	ABM	500 ng	EUR 603

CCNE2 Protein Vector (Mouse) (pPM-C-HA)
PV162908	ABM	500 ng	EUR 603

CCNE2 Protein Vector (Mouse) (pPM-C-His)
PV162909	ABM	500 ng	EUR 603

CCNE2 Protein Vector (Mouse) (pPB-C-His)
PV162910	ABM	500 ng	EUR 603

CCNE2 Protein Vector (Mouse) (pPB-N-His)
PV162911	ABM	500 ng	EUR 603

CCNE2 Protein Vector (Mouse) (pPM-C-HA)
PV162912	ABM	500 ng	EUR 603

CCNE2 Protein Vector (Mouse) (pPM-C-His)
PV162913	ABM	500 ng	EUR 603

CCNE2 Protein Vector (Rat) (pPB-C-His)
PV258294	ABM	500 ng	EUR 603

CCNE2 Protein Vector (Rat) (pPB-N-His)
PV258295	ABM	500 ng	EUR 603

CCNE2 Protein Vector (Rat) (pPM-C-HA)
PV258296	ABM	500 ng	EUR 603

CCNE2 Protein Vector (Rat) (pPM-C-His)
PV258297	ABM	500 ng	EUR 603

CCNE2 Protein Vector (Human) (pPB-C-His)
PV008233	ABM	500 ng	EUR 329

CCNE2 Protein Vector (Human) (pPB-N-His)
PV008234	ABM	500 ng	EUR 329

CCNE2 Protein Vector (Human) (pPM-C-HA)
PV008235	ABM	500 ng	EUR 329

CCNE2 Protein Vector (Human) (pPM-C-His)
PV008236	ABM	500 ng	EUR 329

CCNE2 Protein Vector (Human) (pPB-C-His)
PV008237	ABM	500 ng	EUR 329

CCNE2 Protein Vector (Human) (pPB-N-His)
PV008238	ABM	500 ng	EUR 329