CCNE2

CCNE2 Antibody

1-CSB-PA004818ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CCNE2 Antibody

1-CSB-PA004818GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CCNE2 Antibody

1-CSB-PA070235
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

CCNE2 Antibody

1-CSB-PA285746
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CCNE2 Antibody

36821-100ul 100ul
EUR 252.00

CCNE2 siRNA

20-abx910830
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCNE2 siRNA

20-abx910831
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCNE2 antibody

70R-16236 50 ul
EUR 435.00
Description: Rabbit polyclonal CCNE2 antibody

CCNE2 antibody

70R-10486 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal CCNE2 antibody

CCNE2 Conjugated Antibody

C36821 100ul
EUR 397.00

CCNE2 cloning plasmid

CSB-CL004818HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 891
  • Sequence: atgtcaaaagaagtctggctaaacatgttaaaaaaggagagcagatatgttcatgacaaacattttgaagttctgcattctgacttggaaccacagatgaggtccatacttctagactggcttttagaggtatgtgaagtatacacacttcatagggaaacattttatcttgcaca
  • Show more
Description: A cloning plasmid for the CCNE2 gene.

CCNE2 cloning plasmid

CSB-CL004818HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1125
  • Sequence: atgtcaagacgaagtagccgtttacaagctaagcagcagccccagcccagccagacggaatccccccaagaagcccagataatccaggccaagaagaggaaaactacccaggatgtcaaaaaaagaagagaggaggtcaccaagaaacatcagtatgaaattaggaattgttggc
  • Show more
Description: A cloning plasmid for the CCNE2 gene.

CCNE2 Blocking Peptide

33R-9328 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCNE2 antibody, catalog no. 70R-10486

CCNE2 Rabbit pAb

A4272-100ul 100 ul
EUR 308.00

CCNE2 Rabbit pAb

A4272-200ul 200 ul
EUR 459.00

CCNE2 Rabbit pAb

A4272-20ul 20 ul
EUR 183.00

CCNE2 Rabbit pAb

A4272-50ul 50 ul
EUR 223.00

CCNE2 Polyclonal Antibody

E-AB-12357-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are charact
  • Show more
Description: Rabbit antibody against Human CCNE2 for IHC,ELISA applications.

CCNE2 Polyclonal Antibody

E-AB-12357-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are charact
  • Show more
Description: Rabbit antibody against Human CCNE2 for IHC,ELISA applications.

CCNE2 Polyclonal Antibody

E-AB-12357-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are charact
  • Show more
Description: Rabbit antibody against Human CCNE2 for IHC,ELISA applications.

CCNE2 Rabbit pAb

A14086-100ul 100 ul
EUR 308.00

CCNE2 Rabbit pAb

A14086-200ul 200 ul
EUR 459.00

CCNE2 Rabbit pAb

A14086-20ul 20 ul
EUR 183.00

CCNE2 Rabbit pAb

A14086-50ul 50 ul
EUR 223.00

CCNE2 Rabbit pAb

A7032-100ul 100 ul
EUR 308.00

CCNE2 Rabbit pAb

A7032-200ul 200 ul
EUR 459.00

CCNE2 Rabbit pAb

A7032-20ul 20 ul
EUR 183.00

CCNE2 Rabbit pAb

A7032-50ul 50 ul
EUR 223.00

Anti-CCNE2 antibody

STJ22953 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells.

Anti-CCNE2 antibody

STJ29112 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells.

Anti-CCNE2 antibody

STJ116021 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells.

Phospho-CCNE2 (T392) Antibody

1-CSB-PA070234
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CCNE2 (T392). Recognizes Phospho-CCNE2 (T392) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/10000

Cyclin E2 (CCNE2) Antibody

20-abx003169
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody

20-abx006418
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody

20-abx326211
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody

20-abx320783
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody

20-abx321826
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody

20-abx210917
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse CCNE2 shRNA Plasmid

20-abx969527
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCNE2 shRNA Plasmid

20-abx956041
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pECMV-3-FLAG-CCNE2

PVT13314 2 ug
EUR 599.00

CCNE2 Recombinant Protein (Rat)

RP193718 100 ug Ask for price

CCNE2 Recombinant Protein (Human)

RP006175 100 ug Ask for price

CCNE2 Recombinant Protein (Human)

RP006178 100 ug Ask for price

CCNE2 Recombinant Protein (Mouse)

RP122177 100 ug Ask for price

CCNE2 Recombinant Protein (Mouse)

RP122180 100 ug Ask for price

Cyclin E2 (CCNE2) polyclonal antibody

ABP-PAB-10122 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

CCNE2 ORF Vector (Human) (pORF)

ORF002059 1.0 ug DNA
EUR 95.00

CCNE2 ORF Vector (Human) (pORF)

ORF002060 1.0 ug DNA
EUR 95.00

Ccne2 ORF Vector (Rat) (pORF)

ORF064574 1.0 ug DNA
EUR 506.00

Ccne2 ORF Vector (Mouse) (pORF)

ORF040727 1.0 ug DNA
EUR 506.00

Ccne2 ORF Vector (Mouse) (pORF)

ORF040728 1.0 ug DNA
EUR 506.00

h CCNE2 inducible lentiviral particles

LVP884 1x107 IFU/ml x 200ul
EUR 451.00
Description: Pre-made over-expression lentivirus for expressing human target: CCNE2 (cyclin E2), [alternative names: CYCE2]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_057749.2. It also contains a RFP-Blasticidin dual selection marker.

Mouse Cyclin E2 (CCNE2) ELISA Kit

abx353184-96tests 96 tests
EUR 786.00
  • Shipped within 5-12 working days.

Rat Cyclin E2 (CCNE2) ELISA Kit

abx354051-96tests 96 tests
EUR 786.00
  • Shipped within 5-12 working days.

Human Cyclin E2 (CCNE2) ELISA Kit

abx259514-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Mouse CCNE2(Cyclin-E2) ELISA Kit

E-EL-M1316-192 192 tests
EUR 895.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CCNE2. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Mouse CCNE2 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Mouse CCNE2, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Mouse CCNE2. You can calculate the concentration of Mouse CCNE2 in the samples by comparing the OD of the samples to the standard curve.

Mouse CCNE2(Cyclin-E2) ELISA Kit

E-EL-M1316-96 96 tests
EUR 530.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CCNE2. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Mouse CCNE2 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Mouse CCNE2, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Mouse CCNE2. You can calculate the concentration of Mouse CCNE2 in the samples by comparing the OD of the samples to the standard curve.

Rat CCNE2(Cyclin-E2) ELISA Kit

E-EL-R1143-192 192 tests
EUR 895.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CCNE2. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Rat CCNE2 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Rat CCNE2, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Rat CCNE2. You can calculate the concentration of Rat CCNE2 in the samples by comparing the OD of the samples to the standard curve.

Rat CCNE2(Cyclin-E2) ELISA Kit

E-EL-R1143-96 96 tests
EUR 530.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CCNE2. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Rat CCNE2 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Rat CCNE2, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Rat CCNE2. You can calculate the concentration of Rat CCNE2 in the samples by comparing the OD of the samples to the standard curve.

CCNE2 sgRNA CRISPR Lentivector set (Human)

K0392701 3 x 1.0 ug
EUR 339.00

Ccne2 sgRNA CRISPR Lentivector set (Rat)

K6451901 3 x 1.0 ug
EUR 339.00

Ccne2 sgRNA CRISPR Lentivector set (Mouse)

K3766801 3 x 1.0 ug
EUR 339.00

Human Cyclin E2(CCNE2)ELISA Kit

QY-E00935 96T
EUR 361.00

Cyclin E2 Phospho-Thr392 (CCNE2 pT392) Antibody

20-abx325115
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rabbit Anti-CCNE2 monoclonal antibody, clone TE3146

DCABH-8531 100 ul
EUR 777.00

ELISA kit for Mouse CCNE2 (Cyclin-E2)

E-EL-M1316 1 plate of 96 wells
EUR 534.00
  • Gentaur's CCNE2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CCNE2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CCNE2 (Cyclin-E2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat CCNE2 (Cyclin-E2)

E-EL-R1143 1 plate of 96 wells
EUR 534.00
  • Gentaur's CCNE2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CCNE2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat CCNE2 (Cyclin-E2) in samples from Serum, Plasma, Cell supernatant

CCNE2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0392702 1.0 ug DNA
EUR 154.00

CCNE2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0392703 1.0 ug DNA
EUR 154.00

CCNE2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0392704 1.0 ug DNA
EUR 154.00

Ccne2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6451902 1.0 ug DNA
EUR 154.00

Ccne2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6451903 1.0 ug DNA
EUR 154.00

Ccne2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6451904 1.0 ug DNA
EUR 154.00

Ccne2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3766802 1.0 ug DNA
EUR 154.00

Ccne2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3766803 1.0 ug DNA
EUR 154.00

Ccne2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3766804 1.0 ug DNA
EUR 154.00

CCNE2 Protein Vector (Human) (pPB-C-His)

PV008233 500 ng
EUR 329.00

CCNE2 Protein Vector (Human) (pPB-N-His)

PV008234 500 ng
EUR 329.00

CCNE2 Protein Vector (Human) (pPM-C-HA)

PV008235 500 ng
EUR 329.00

CCNE2 Protein Vector (Human) (pPM-C-His)

PV008236 500 ng
EUR 329.00

CCNE2 Protein Vector (Human) (pPB-C-His)

PV008237 500 ng
EUR 329.00

CCNE2 Protein Vector (Human) (pPB-N-His)

PV008238 500 ng
EUR 329.00

CCNE2 Protein Vector (Human) (pPM-C-HA)

PV008239 500 ng
EUR 329.00

CCNE2 Protein Vector (Human) (pPM-C-His)

PV008240 500 ng
EUR 329.00

CCNE2 Protein Vector (Mouse) (pPB-C-His)

PV162906 500 ng
EUR 603.00

CCNE2 Protein Vector (Mouse) (pPB-N-His)

PV162907 500 ng
EUR 603.00

CCNE2 Protein Vector (Mouse) (pPM-C-HA)

PV162908 500 ng
EUR 603.00

CCNE2 Protein Vector (Mouse) (pPM-C-His)

PV162909 500 ng
EUR 603.00

CCNE2 Protein Vector (Mouse) (pPB-C-His)

PV162910 500 ng
EUR 603.00