  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCNE2 Antibody

36821-100ul 100ul
EUR 252

CCNE2 antibody

70R-10486 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CCNE2 antibody

CCNE2 antibody

70R-16236 50 ul
EUR 435
Description: Rabbit polyclonal CCNE2 antibody

CCNE2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CCNE2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CCNE2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CCNE2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CCNE2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCNE2. Recognizes CCNE2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

CCNE2 Conjugated Antibody

C36821 100ul
EUR 397

CCNE2 cloning plasmid

CSB-CL004818HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 891
  • Sequence: atgtcaaaagaagtctggctaaacatgttaaaaaaggagagcagatatgttcatgacaaacattttgaagttctgcattctgacttggaaccacagatgaggtccatacttctagactggcttttagaggtatgtgaagtatacacacttcatagggaaacattttatcttgcaca
  • Show more
Description: A cloning plasmid for the CCNE2 gene.

CCNE2 cloning plasmid

CSB-CL004818HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1125
  • Sequence: atgtcaagacgaagtagccgtttacaagctaagcagcagccccagcccagccagacggaatccccccaagaagcccagataatccaggccaagaagaggaaaactacccaggatgtcaaaaaaagaagagaggaggtcaccaagaaacatcagtatgaaattaggaattgttggc
  • Show more
Description: A cloning plasmid for the CCNE2 gene.

CCNE2 Rabbit pAb

A7032-100ul 100 ul
EUR 308

CCNE2 Rabbit pAb

A7032-200ul 200 ul
EUR 459

CCNE2 Rabbit pAb

A7032-20ul 20 ul
EUR 183

CCNE2 Rabbit pAb

A7032-50ul 50 ul
EUR 223

CCNE2 Rabbit pAb

A4272-100ul 100 ul
EUR 308

CCNE2 Rabbit pAb

A4272-200ul 200 ul
EUR 459

CCNE2 Rabbit pAb

A4272-20ul 20 ul
EUR 183

CCNE2 Rabbit pAb

A4272-50ul 50 ul
EUR 223

CCNE2 Rabbit pAb

A14086-100ul 100 ul
EUR 308

CCNE2 Rabbit pAb

A14086-200ul 200 ul
EUR 459

CCNE2 Rabbit pAb

A14086-20ul 20 ul
EUR 183

CCNE2 Rabbit pAb

A14086-50ul 50 ul
EUR 223

CCNE2 Blocking Peptide

33R-9328 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCNE2 antibody, catalog no. 70R-10486

Anti-CCNE2 antibody

STJ29112 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells.

Anti-CCNE2 antibody

STJ22953 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells.

Anti-CCNE2 antibody

STJ116021 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells.

Cyclin E2 (CCNE2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin E2 (CCNE2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human CCNE2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCNE2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-CCNE2 (T392) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CCNE2 (T392). Recognizes Phospho-CCNE2 (T392) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/10000

CCNE2 Recombinant Protein (Human)

RP006175 100 ug Ask for price

CCNE2 Recombinant Protein (Human)

RP006178 100 ug Ask for price


PVT13314 2 ug
EUR 599

CCNE2 Recombinant Protein (Rat)

RP193718 100 ug Ask for price

CCNE2 Recombinant Protein (Mouse)

RP122177 100 ug Ask for price

CCNE2 Recombinant Protein (Mouse)

RP122180 100 ug Ask for price

Cyclin E2 (CCNE2) polyclonal antibody

ABP-PAB-10122 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

CCNE2 ORF Vector (Human) (pORF)

ORF002059 1.0 ug DNA
EUR 95

CCNE2 ORF Vector (Human) (pORF)

ORF002060 1.0 ug DNA
EUR 95

h CCNE2 inducible lentiviral particles

LVP884 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: CCNE2 (cyclin E2), [alternative names: CYCE2]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_057749.2. It also contains a RFP-Blasticidin dual selection marker.

Ccne2 ORF Vector (Mouse) (pORF)

ORF040727 1.0 ug DNA
EUR 506

Ccne2 ORF Vector (Mouse) (pORF)

ORF040728 1.0 ug DNA
EUR 506

Ccne2 ORF Vector (Rat) (pORF)

ORF064574 1.0 ug DNA
EUR 506

CCNE2 ELISA Kit (Mouse) (OKEI00583)

OKEI00583 96 Wells
EUR 767
Description: Description of target: Essential for the control of the cell cycle at the late G1 and early S phase. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL

CCNE2 ELISA Kit (Rat) (OKEI00884)

OKEI00884 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL

CCNE2 sgRNA CRISPR Lentivector set (Human)

K0392701 3 x 1.0 ug
EUR 339

Human Cyclin E2 (CCNE2) ELISA Kit

abx259514-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Cyclin E2 (CCNE2) ELISA Kit

abx353184-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Cyclin E2 (CCNE2) ELISA Kit

abx354051-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Ccne2 sgRNA CRISPR Lentivector set (Mouse)

K3766801 3 x 1.0 ug
EUR 339

Ccne2 sgRNA CRISPR Lentivector set (Rat)

K6451901 3 x 1.0 ug
EUR 339

Human Cyclin E2(CCNE2)ELISA Kit

QY-E00935 96T
EUR 361

CCNE2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0392702 1.0 ug DNA
EUR 154

CCNE2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0392703 1.0 ug DNA
EUR 154

CCNE2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0392704 1.0 ug DNA
EUR 154

Cyclin E2 Phospho-Thr392 (CCNE2 pT392) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ccne2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3766802 1.0 ug DNA
EUR 154

Ccne2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3766803 1.0 ug DNA
EUR 154

Ccne2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3766804 1.0 ug DNA
EUR 154

Ccne2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6451902 1.0 ug DNA
EUR 154

Ccne2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6451903 1.0 ug DNA
EUR 154

Ccne2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6451904 1.0 ug DNA
EUR 154

Rabbit Anti-CCNE2 monoclonal antibody, clone TE3146

DCABH-8531 100 ul
EUR 777

ELISA kit for Mouse CCNE2 (Cyclin-E2)

E-EL-M1316 1 plate of 96 wells
EUR 534
  • Gentaur's CCNE2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CCNE2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CCNE2 (Cyclin-E2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat CCNE2 (Cyclin-E2)

E-EL-R1143 1 plate of 96 wells
EUR 534
  • Gentaur's CCNE2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CCNE2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat CCNE2 (Cyclin-E2) in samples from Serum, Plasma, Cell supernatant

CCNE2 Protein Vector (Human) (pPB-C-His)

PV008233 500 ng
EUR 329

CCNE2 Protein Vector (Human) (pPB-N-His)

PV008234 500 ng
EUR 329

CCNE2 Protein Vector (Human) (pPM-C-HA)

PV008235 500 ng
EUR 329

CCNE2 Protein Vector (Human) (pPM-C-His)

PV008236 500 ng
EUR 329

CCNE2 Protein Vector (Human) (pPB-C-His)

PV008237 500 ng
EUR 329

CCNE2 Protein Vector (Human) (pPB-N-His)

PV008238 500 ng
EUR 329

CCNE2 Protein Vector (Human) (pPM-C-HA)

PV008239 500 ng
EUR 329

CCNE2 Protein Vector (Human) (pPM-C-His)

PV008240 500 ng
EUR 329

CCNE2 Protein Vector (Rat) (pPB-C-His)

PV258294 500 ng
EUR 603

CCNE2 Protein Vector (Rat) (pPB-N-His)

PV258295 500 ng
EUR 603

CCNE2 Protein Vector (Rat) (pPM-C-HA)

PV258296 500 ng
EUR 603

CCNE2 Protein Vector (Rat) (pPM-C-His)

PV258297 500 ng
EUR 603

CCNE2 Protein Vector (Mouse) (pPB-C-His)

PV162906 500 ng
EUR 603

CCNE2 Protein Vector (Mouse) (pPB-N-His)

PV162907 500 ng
EUR 603

CCNE2 Protein Vector (Mouse) (pPM-C-HA)

PV162908 500 ng
EUR 603

CCNE2 Protein Vector (Mouse) (pPM-C-His)

PV162909 500 ng
EUR 603

CCNE2 Protein Vector (Mouse) (pPB-C-His)

PV162910 500 ng
EUR 603

CCNE2 Protein Vector (Mouse) (pPB-N-His)

PV162911 500 ng
EUR 603