CCT5 antibody

70R-16249 50 ul
EUR 435
Description: Rabbit polyclonal CCT5 antibody

CCT5 Antibody

35090-100ul 100ul
EUR 252

CCT5 Antibody

35090-50ul 50ul
EUR 187

CCT5 antibody

39001-100ul 100ul
EUR 252

CCT5 Antibody

43069-100ul 100ul
EUR 252

CCT5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT5. Recognizes CCT5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

CCT5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCT5. Recognizes CCT5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

CCT5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCT5. Recognizes CCT5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CCT5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CCT5. Recognizes CCT5 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CCT5 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CCT5. Recognizes CCT5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CCT5 Antibody

CSB-PA111204-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CCT5. Recognizes CCT5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CCT5 Antibody

DF4559 200ul
EUR 304
Description: CCT5 Antibody detects endogenous levels of total CCT5.

CCT5 antibody

70R-3888 50 ug
EUR 467
Description: Rabbit polyclonal CCT5 antibody

CCT5 antibody

70R-4224 50 ug
EUR 467
Description: Rabbit polyclonal CCT5 antibody

CCT5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCT5. Recognizes CCT5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCT5 Antibody

ABD4559 100 ug
EUR 438


PVT12330 2 ug
EUR 391

CCT5 Blocking Peptide

33R-1872 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCT5 antibody, catalog no. 70R-3888

CCT5 Blocking Peptide

33R-6657 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCT5 antibody, catalog no. 70R-4224

CCT5 Blocking Peptide

DF4559-BP 1mg
EUR 195

CCT5 Conjugated Antibody

C43069 100ul
EUR 397

CCT5 Conjugated Antibody

C39001 100ul
EUR 397

CCT5 cloning plasmid

CSB-CL004862HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1626
  • Sequence: atggcgtccatggggaccctcgccttcgatgaatatgggcgccctttcctcatcatcaaggatcaggaccgcaagtcccgtcttatgggacttgaggccctcaagtctcatataatggcagcaaaggctgtagcaaatacaatgagaacatcacttggaccaaatgggcttgata
  • Show more
Description: A cloning plasmid for the CCT5 gene.

CCT5 Rabbit pAb

A6549-100ul 100 ul
EUR 308

CCT5 Rabbit pAb

A6549-200ul 200 ul
EUR 459

CCT5 Rabbit pAb

A6549-20ul 20 ul
EUR 183

CCT5 Rabbit pAb

A6549-50ul 50 ul
EUR 223

anti- CCT5 antibody

FNab01400 100µg
EUR 505.25
  • Immunogen: chaperonin containing TCP1, subunit 5(epsilon)
  • Uniprot ID: P48643
  • Gene ID: 22948
  • Research Area: Metabolism
Description: Antibody raised against CCT5

Anti-CCT5 antibody

PAab01400 100 ug
EUR 355

Anti-CCT5 antibody

STJ28632 100 µl
EUR 277
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Mutations in this gene cause hereditary sensory and autonomic neuropathy with spastic paraplegia (HSNSP). Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 5 and 13.

CCT5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT5. Recognizes CCT5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCT5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT5. Recognizes CCT5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCT5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT5. Recognizes CCT5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF008481 96 Tests
EUR 689

Rat CCT5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCT5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCT5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCT5 Recombinant Protein (Human)

RP006253 100 ug Ask for price

CCT5 Recombinant Protein (Rat)

RP193817 100 ug Ask for price

CCT5 Recombinant Protein (Mouse)

RP122312 100 ug Ask for price

Cct5 ORF Vector (Rat) (pORF)

ORF064607 1.0 ug DNA
EUR 506

CCT5 ORF Vector (Human) (pORF)

ORF002085 1.0 ug DNA
EUR 95

Cct5 ORF Vector (Mouse) (pORF)

ORF040772 1.0 ug DNA
EUR 506

Anti-TCP1 epsilon/CCT5 Antibody

PB9928 100ug/vial
EUR 334

CCT5 ELISA Kit (Human) (OKCA00833)

OKCA00833 96 Wells
EUR 833
Description: Description of target: Molecular chaperone; assists the folding of proteins upon ATP hydrolysis. As part of the BBS/CCT complex may play a role in the assembly of BBSome, a complex involved in ciliogenesis regulating transports vesicles to the cilia. Known to play a role, in vitro, in the folding of actin and tubulin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

CCT5 sgRNA CRISPR Lentivector set (Human)

K0397001 3 x 1.0 ug
EUR 339

Cct5 sgRNA CRISPR Lentivector set (Rat)

K7181101 3 x 1.0 ug
EUR 339

Cct5 sgRNA CRISPR Lentivector set (Mouse)

K3386301 3 x 1.0 ug
EUR 339

Chaperonin Containing TCP1, Subunit 5 (CCT5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyclonal CCT5 / TCP1 Epsilon Antibody (aa89-338)

APR15322G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCT5 / TCP1 Epsilon (aa89-338). This antibody is tested and proven to work in the following applications:

CCT5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0397002 1.0 ug DNA
EUR 154

CCT5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0397003 1.0 ug DNA
EUR 154

CCT5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0397004 1.0 ug DNA
EUR 154

Cct5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7181102 1.0 ug DNA
EUR 154

Cct5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7181103 1.0 ug DNA
EUR 154

Cct5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7181104 1.0 ug DNA
EUR 154

Cct5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3386302 1.0 ug DNA
EUR 154

Cct5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3386303 1.0 ug DNA
EUR 154

Cct5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3386304 1.0 ug DNA
EUR 154

CCT5 Protein Vector (Mouse) (pPB-C-His)

PV163086 500 ng
EUR 603

CCT5 Protein Vector (Mouse) (pPB-N-His)

PV163087 500 ng
EUR 603

CCT5 Protein Vector (Mouse) (pPM-C-HA)

PV163088 500 ng
EUR 603

CCT5 Protein Vector (Mouse) (pPM-C-His)

PV163089 500 ng
EUR 603

CCT5 Protein Vector (Rat) (pPB-C-His)

PV258426 500 ng
EUR 603

CCT5 Protein Vector (Rat) (pPB-N-His)

PV258427 500 ng
EUR 603

CCT5 Protein Vector (Rat) (pPM-C-HA)

PV258428 500 ng
EUR 603

CCT5 Protein Vector (Rat) (pPM-C-His)

PV258429 500 ng
EUR 603

CCT5 Protein Vector (Human) (pPB-C-His)

PV008337 500 ng
EUR 329

CCT5 Protein Vector (Human) (pPB-N-His)

PV008338 500 ng
EUR 329

CCT5 Protein Vector (Human) (pPM-C-HA)

PV008339 500 ng
EUR 329

CCT5 Protein Vector (Human) (pPM-C-His)

PV008340 500 ng
EUR 329

Cct5 3'UTR GFP Stable Cell Line

TU153439 1.0 ml Ask for price

Cct5 3'UTR Luciferase Stable Cell Line

TU103439 1.0 ml Ask for price

Cct5 3'UTR Luciferase Stable Cell Line

TU201925 1.0 ml Ask for price

Cct5 3'UTR GFP Stable Cell Line

TU251925 1.0 ml Ask for price

CCT5 3'UTR GFP Stable Cell Line

TU053836 1.0 ml
EUR 1521

CCT5 3'UTR Luciferase Stable Cell Line

TU003836 1.0 ml
EUR 1521

T-Complex Protein 1 Subunit Epsilon (CCT5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Epsilon (CCT5) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Epsilon (CCT5) Antibody

abx146204-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Monoclonal CCT5 Antibody (monoclonal) (M01), Clone: 4E5-4B1

APR15324G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CCT5 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4E5-4B1. This antibody is applicable in WB, IHC and IF, E

T-Complex Protein 1 Subunit Epsilon (CCT5) Antibody

abx413782-01mg 0.1 mg
EUR 495
  • Shipped within 1 week.

T-Complex Protein 1 Subunit Epsilon (CCT5) Antibody

abx330863-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Epsilon (CCT5) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Epsilon (CCT5) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Epsilon (CCT5) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Epsilon (CCT5) Antibody

abx231400-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.