CDC20

Cdc20(CDC20/1102) Antibody

BNC801102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF680 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC801102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF680 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNUM1102-50 50uL
EUR 395.00
Description: Primary antibody against Cdc20(CDC20/1102), 1mg/mL

Cdc20(CDC20/1102) Antibody

BNC041102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF405S conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC041102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF405S conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC051102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF405M conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC051102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF405M conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC401102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF640R conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC401102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF640R conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC881102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF488A conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC881102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF488A conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC681102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF568 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC681102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF568 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC941102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF594 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC701102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF770 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC701102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF770 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNCH1102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNCH1102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNCP1102-250 250uL
EUR 383.00
Description: Primary antibody against Cdc20(CDC20/1102), PerCP conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNCR1102-250 250uL
EUR 383.00
Description: Primary antibody against Cdc20(CDC20/1102), RPE conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNCAP1102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNCAP1102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC811102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF680R conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC811102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF680R conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNCB1102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), Biotin conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNCB1102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), Biotin conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNUB1102-100 100uL
EUR 209.00
Description: Primary antibody against Cdc20(CDC20/1102), Concentration: 0.2mg/mL

Cdc20(CDC20/1102) Antibody

BNUB1102-500 500uL
EUR 458.00
Description: Primary antibody against Cdc20(CDC20/1102), Concentration: 0.2mg/mL

Cdc20(CDC20/1102) Antibody

BNC431102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF543 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC431102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF543 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC471102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF647 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC471102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF647 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC551102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF555 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC551102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF555 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC941102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF594 conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC611102-100 100uL
EUR 199.00
Description: Primary antibody against Cdc20(CDC20/1102), CF660R conjugate, Concentration: 0.1mg/mL

Cdc20(CDC20/1102) Antibody

BNC611102-500 500uL
EUR 544.00
Description: Primary antibody against Cdc20(CDC20/1102), CF660R conjugate, Concentration: 0.1mg/mL

Anti-Cdc20 Antibody (CDC20/1102)

A1572-100
EUR 479.00

Cdc20/ Rat Cdc20 ELISA Kit

ELI-50289r 96 Tests
EUR 886.00

CDC20 siRNA

20-abx911120
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC20 siRNA

20-abx911121
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC20 siRNA

20-abx900931
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC20 antibody

70R-32340 100 ug
EUR 327.00
Description: Rabbit polyclonal CDC20 antibody

CDC20 antibody

70R-49511 100 ul
EUR 244.00
Description: Purified Polyclonal CDC20 antibody

CDC20 antibody

70R-16295 50 ul
EUR 435.00
Description: Rabbit polyclonal CDC20 antibody

CDC20 Antibody

ABD6363 100 ug
EUR 438.00

CDC20 antibody

70R-10477 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal CDC20 antibody

CDC20 Antibody

1-CSB-PA001497
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC20. Recognizes CDC20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

CDC20 Antibody

1-CSB-PA153558
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC20. Recognizes CDC20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:10-1:50

CDC20 Antibody

1-CSB-PA947265
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC20. Recognizes CDC20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:5-1:20

CDC20 Antibody

DF6363 200ul
EUR 304.00
Description: CDC20 Antibody detects endogenous levels of total CDC20.

CDC20 Antibody

34189-100ul 100ul
EUR 252.00

CDC20 Antibody

34189-50ul 50ul
EUR 187.00

CDC20 Antibody

31052-100ul 100ul
EUR 252.00

CDC20 Antibody

31052-50ul 50ul
EUR 187.00

CDC20 Antibody

32246-100ul 100ul
EUR 252.00

CDC20 Antibody

1-CSB-PA004990GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDC20. Recognizes CDC20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CDC20 Antibody

AF4759 200ul
EUR 376.00
Description: CDC20 Antibody detects endogenous levels of CDC20.

CDC20 Antibody

AF7946 200ul
EUR 376.00
Description: CDC20 Antibody detects endogenous levels of CDC20.

Cdc20 antibody

PAab09997 100 ug
EUR 386.00

pOTB7-CDC20

PVT18795 2 ug
EUR 231.00

anti-CDC20

YF-PA10831 100 ug
EUR 403.00
Description: Rabbit polyclonal to CDC20

Anti-Cdc20 Antibody Clone CDC20/1102, Unconjugated-100ug

991-MSM2-P1 100ug
EUR 428.00

CDC20 Polyclonal Antibody

E-AB-10218-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: CDC20 appears to act as a regulatory protein interacting with several other proteins at multiple points i
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat CDC20 for WB,IHC,ELISA applications.

CDC20 Polyclonal Antibody

E-AB-10218-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: CDC20 appears to act as a regulatory protein interacting with several other proteins at multiple points i
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat CDC20 for WB,IHC,ELISA applications.

CDC20 Polyclonal Antibody

E-AB-10218-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: CDC20 appears to act as a regulatory protein interacting with several other proteins at multiple points i
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat CDC20 for WB,IHC,ELISA applications.

Anti-Cdc20 Antibody

A00382-1 100ug/vial
EUR 334.00

Cdc20 Polyclonal Antibody

ABP50925-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human Cdc20 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc20 from Human, Mouse, Rat. This Cdc20 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Cdc20 at AA range: 50-130

Cdc20 Polyclonal Antibody

ABP50925-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human Cdc20 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc20 from Human, Mouse, Rat. This Cdc20 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Cdc20 at AA range: 50-130

Cdc20 Polyclonal Antibody

ABP50925-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human Cdc20 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc20 from Human, Mouse, Rat. This Cdc20 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Cdc20 at AA range: 50-130

CDC20 Rabbit pAb

A1231-100ul 100 ul
EUR 308.00

CDC20 Rabbit pAb

A1231-20ul 20 ul
EUR 183.00

CDC20 Rabbit pAb

A15656-100ul 100 ul
EUR 308.00

CDC20 Rabbit pAb

A15656-200ul 200 ul
EUR 459.00

CDC20 Rabbit pAb

A15656-20ul 20 ul
EUR 183.00

CDC20 Rabbit pAb

A15656-50ul 50 ul
EUR 223.00

CDC20 Rabbit pAb

A1231-200ul 200 ul
EUR 459.00

CDC20 Rabbit pAb

A1231-50ul 50 ul
EUR 223.00

Cdc20 Polyclonal Antibody

40712-100ul 100ul
EUR 252.00

Cdc20 Polyclonal Antibody

40712-50ul 50ul
EUR 187.00

CDC20 Blocking Peptide

DF6363-BP 1mg
EUR 195.00

CDC20 cloning plasmid

CSB-CL623655HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1500
  • Sequence: atggcacagttcgcgttcgagagtgacctgcactcgctgcttcagctggatgcacccatccccaatgcaccccctgcgcgctggcagcgcaaagccaaggaagccgcaggcccggccccctcacccatgcgggccgccaaccgatcccacagcgccggcaggactccgggccgaa
  • Show more
Description: A cloning plasmid for the CDC20 gene.

CDC20 cloning plasmid

CSB-CL623655HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1500
  • Sequence: atggcacagttcgcgttcgagagtgacctgcactcgctgcttcagctggatgcacccatccccaatgcaccccctgcgcgctggcagcgcaaagccaaggaagccgcaggcccggccccctcacccatgcgggccgccaaccgatcccacagcgccggcaggactccgggccgaa
  • Show more
Description: A cloning plasmid for the CDC20 gene.

CDC20 cloning plasmid

CSB-CL623655HU3-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1500
  • Sequence: atggcacagttcgcgttcgagagtgacctgcactcgctgcttcagctggatgcacccatccccaatgcaccccctgcgcgctggcagcgcaaagccaaggaagccgcaggcccggccccctcacccatgcgggccgccaaccgatcccacagcgccggcaggactccgggccgaa
  • Show more
Description: A cloning plasmid for the CDC20 gene.

CDC20 Blocking Peptide

33R-5724 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CDC20 antibody, catalog no. 70R-10477

CDC20 Blocking Peptide

20-abx062386
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CDC20 Polyclonal Antibody

E-AB-30846-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: CDC20 appears to act as a regulatory protein interacting with several other proteins at mult
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat CDC20 for WB,IHC-p,ELISA applications.

CDC20 Polyclonal Antibody

E-AB-30846-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: CDC20 appears to act as a regulatory protein interacting with several other proteins at mult
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat CDC20 for WB,IHC-p,ELISA applications.

CDC20 Polyclonal Antibody

E-AB-30846-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: CDC20 appears to act as a regulatory protein interacting with several other proteins at mult
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat CDC20 for WB,IHC-p,ELISA applications.

Polyclonal CDC20 Antibody

APR03368G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDC20 . This antibody is tested and proven to work in the following applications: