CNIH3

CNIH3 Antibody

1-CSB-PA005650GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CNIH3. Recognizes CNIH3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CNIH3 Antibody

1-CSB-PA848394LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNIH3. Recognizes CNIH3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

CNIH3 siRNA

20-abx901146
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNIH3 siRNA

20-abx912246
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNIH3 siRNA

20-abx912247
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNIH3 antibody

70R-16471 50 ul
EUR 435.00
Description: Rabbit polyclonal CNIH3 antibody

anti-CNIH3

YF-PA22434 50 ug
EUR 363.00
Description: Mouse polyclonal to CNIH3

CNIH3 cloning plasmid

CSB-CL848394HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 483
  • Sequence: atggccttcactttcgctgcgttctgctacatgctgtctctggtgctgtgcgctgcgctcatcttcttcgccatctggcacataattgcctttgatgagttaaggacagattttaagagccccatagaccagtgcaatcctgttcatgcgagggaacggttgaggaacatcgagcg
  • Show more
Description: A cloning plasmid for the CNIH3 gene.

CNIH3 Polyclonal Antibody

A66870 100 µg
EUR 570.55
Description: The best epigenetics products

anti- CNIH3 antibody

FNab01797 100µg
EUR 548.75
  • Immunogen: cornichon homolog 3(Drosophila)
  • Uniprot ID: Q8TBE1
  • Gene ID: 149111
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against CNIH3

Anti-CNIH3 antibody

PAab01797 100 ug
EUR 386.00

Anti-CNIH3 (1E10)

YF-MA19921 100 ug
EUR 363.00
Description: Mouse monoclonal to CNIH3

Rat CNIH3 shRNA Plasmid

20-abx991200
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CNIH3 shRNA Plasmid

20-abx977891
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CNIH3 Antibody, HRP conjugated

1-CSB-PA848394LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNIH3. Recognizes CNIH3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CNIH3 Antibody, FITC conjugated

1-CSB-PA848394LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNIH3. Recognizes CNIH3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CNIH3 Antibody, Biotin conjugated

1-CSB-PA848394LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNIH3. Recognizes CNIH3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human CNIH3 shRNA Plasmid

20-abx965607
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CNIH3 ELISA KIT|Human

EF008752 96 Tests
EUR 689.00

CNIH3 Recombinant Protein (Rat)

RP195587 100 ug Ask for price

CNIH3 Recombinant Protein (Human)

RP007480 100 ug Ask for price

CNIH3 Recombinant Protein (Mouse)

RP124985 100 ug Ask for price

CNIH3 Recombinant Protein (Mouse)

RP124988 100 ug Ask for price

CNIH3 Recombinant Protein (Mouse)

RP124991 100 ug Ask for price

Polyclonal CNIH3 Antibody (N-term)

APR04222G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNIH3 (N-term). This antibody is tested and proven to work in the following applications:

CNIH3 Polyclonal Antibody, HRP Conjugated

A66871 100 µg
EUR 570.55
Description: kits suitable for this type of research

CNIH3 Polyclonal Antibody, FITC Conjugated

A66872 100 µg
EUR 570.55
Description: fast delivery possible

CNIH3 Polyclonal Antibody, Biotin Conjugated

A66873 100 µg
EUR 570.55
Description: reagents widely cited

CNIH3 ORF Vector (Human) (pORF)

ORF002494 1.0 ug DNA
EUR 95.00

Cnih3 ORF Vector (Rat) (pORF)

ORF065197 1.0 ug DNA
EUR 506.00

Cnih3 ORF Vector (Mouse) (pORF)

ORF041663 1.0 ug DNA
EUR 506.00

Cnih3 ORF Vector (Mouse) (pORF)

ORF041664 1.0 ug DNA
EUR 506.00

Cnih3 ORF Vector (Mouse) (pORF)

ORF041665 1.0 ug DNA
EUR 506.00

Protein Cornichon Homolog 3 (CNIH3) Antibody

20-abx116808
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Cornichon Homolog 3 (CNIH3) Antibody

abx029589-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Protein Cornichon Homolog 3 (CNIH3) Antibody

abx029589-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Protein Cornichon Homolog 3 (CNIH3) Antibody

20-abx302033
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Cornichon Homolog 3 (CNIH3) Antibody

abx231797-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Cnih3 sgRNA CRISPR Lentivector set (Mouse)

K3189301 3 x 1.0 ug
EUR 339.00

CNIH3 sgRNA CRISPR Lentivector set (Human)

K0475201 3 x 1.0 ug
EUR 339.00

Cnih3 sgRNA CRISPR Lentivector set (Rat)

K6680401 3 x 1.0 ug
EUR 339.00

Protein Cornichon Homolog 3 (CNIH3) Antibody (HRP)

20-abx309952
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Cornichon Homolog 3 (CNIH3) Antibody (FITC)

20-abx309953
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Cornichon Homolog 3 (CNIH3) Antibody (Biotin)

20-abx309954
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CNIH3 3'UTR Luciferase Stable Cell Line

TU004684 1.0 ml
EUR 1394.00

Cnih3 3'UTR GFP Stable Cell Line

TU252543 1.0 ml Ask for price

Cnih3 3'UTR Luciferase Stable Cell Line

TU104096 1.0 ml Ask for price

Cnih3 3'UTR GFP Stable Cell Line

TU154096 1.0 ml Ask for price

CNIH3 3'UTR GFP Stable Cell Line

TU054684 1.0 ml
EUR 1394.00

Cnih3 3'UTR Luciferase Stable Cell Line

TU202543 1.0 ml Ask for price

CNIH3 Protein Vector (Rat) (pPB-C-His)

PV260786 500 ng
EUR 603.00

CNIH3 Protein Vector (Rat) (pPB-N-His)

PV260787 500 ng
EUR 603.00

CNIH3 Protein Vector (Rat) (pPM-C-HA)

PV260788 500 ng
EUR 603.00

CNIH3 Protein Vector (Rat) (pPM-C-His)

PV260789 500 ng
EUR 603.00

CNIH3 Protein Vector (Human) (pPB-C-His)

PV009973 500 ng
EUR 329.00

CNIH3 Protein Vector (Human) (pPB-N-His)

PV009974 500 ng
EUR 329.00

CNIH3 Protein Vector (Human) (pPM-C-HA)

PV009975 500 ng
EUR 329.00

CNIH3 Protein Vector (Human) (pPM-C-His)

PV009976 500 ng
EUR 329.00

CNIH3 Protein Vector (Mouse) (pPB-C-His)

PV166650 500 ng
EUR 603.00

CNIH3 Protein Vector (Mouse) (pPB-N-His)

PV166651 500 ng
EUR 603.00

CNIH3 Protein Vector (Mouse) (pPM-C-HA)

PV166652 500 ng
EUR 603.00

CNIH3 Protein Vector (Mouse) (pPM-C-His)

PV166653 500 ng
EUR 603.00

CNIH3 Protein Vector (Mouse) (pPB-C-His)

PV166654 500 ng
EUR 603.00

CNIH3 Protein Vector (Mouse) (pPB-N-His)

PV166655 500 ng
EUR 603.00

CNIH3 Protein Vector (Mouse) (pPM-C-HA)

PV166656 500 ng
EUR 603.00

CNIH3 Protein Vector (Mouse) (pPM-C-His)

PV166657 500 ng
EUR 603.00

CNIH3 Protein Vector (Mouse) (pPB-C-His)

PV166658 500 ng
EUR 603.00

CNIH3 Protein Vector (Mouse) (pPB-N-His)

PV166659 500 ng
EUR 603.00

CNIH3 Protein Vector (Mouse) (pPM-C-HA)

PV166660 500 ng
EUR 603.00

CNIH3 Protein Vector (Mouse) (pPM-C-His)

PV166661 500 ng
EUR 603.00