CNIH3

CNIH3 siRNA
20-abx901146	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CNIH3 siRNA
20-abx912246	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CNIH3 siRNA
20-abx912247	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CNIH3 antibody
70R-16471	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CNIH3 antibody

CNIH3 Antibody
1-CSB-PA005650GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CNIH3. Recognizes CNIH3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CNIH3 Antibody
1-CSB-PA848394LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNIH3. Recognizes CNIH3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

anti-CNIH3
YF-PA22434	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CNIH3

anti- CNIH3 antibody
FNab01797	FN Test	100µg	EUR 548.75
Immunogen: cornichon homolog 3(Drosophila) Uniprot ID: Q8TBE1 Gene ID: 149111 Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against CNIH3

CNIH3 Polyclonal Antibody
A66870	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

CNIH3 cloning plasmid
CSB-CL848394HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 483 Sequence: atggccttcactttcgctgcgttctgctacatgctgtctctggtgctgtgcgctgcgctcatcttcttcgccatctggcacataattgcctttgatgagttaaggacagattttaagagccccatagaccagtgcaatcctgttcatgcgagggaacggttgaggaacatcgagcg Show more
Description: A cloning plasmid for the CNIH3 gene.

Anti-CNIH3 antibody
PAab01797	Lifescience Market	100 ug	EUR 386

Anti-CNIH3 (1E10)
YF-MA19921	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CNIH3

Mouse CNIH3 shRNA Plasmid
20-abx977891	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CNIH3 shRNA Plasmid
20-abx965607	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CNIH3 ELISA KIT|Human
EF008752	Lifescience Market	96 Tests	EUR 689

Rat CNIH3 shRNA Plasmid
20-abx991200	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CNIH3 Antibody, HRP conjugated
1-CSB-PA848394LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNIH3. Recognizes CNIH3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CNIH3 Antibody, FITC conjugated
1-CSB-PA848394LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNIH3. Recognizes CNIH3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CNIH3 Antibody, Biotin conjugated
1-CSB-PA848394LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNIH3. Recognizes CNIH3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CNIH3 Recombinant Protein (Human)
RP007480	ABM	100 ug	Ask for price

CNIH3 Recombinant Protein (Rat)
RP195587	ABM	100 ug	Ask for price

CNIH3 Recombinant Protein (Mouse)
RP124985	ABM	100 ug	Ask for price

CNIH3 Recombinant Protein (Mouse)
RP124988	ABM	100 ug	Ask for price

CNIH3 Recombinant Protein (Mouse)
RP124991	ABM	100 ug	Ask for price

Polyclonal CNIH3 Antibody (N-term)
APR04222G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNIH3 (N-term). This antibody is tested and proven to work in the following applications:

CNIH3 Polyclonal Antibody, HRP Conjugated
A66871	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

CNIH3 Polyclonal Antibody, FITC Conjugated
A66872	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

CNIH3 Polyclonal Antibody, Biotin Conjugated
A66873	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

CNIH3 ORF Vector (Human) (pORF)
ORF002494	ABM	1.0 ug DNA	EUR 95

Cnih3 ORF Vector (Rat) (pORF)
ORF065197	ABM	1.0 ug DNA	EUR 506

Cnih3 ORF Vector (Mouse) (pORF)
ORF041663	ABM	1.0 ug DNA	EUR 506

Cnih3 ORF Vector (Mouse) (pORF)
ORF041664	ABM	1.0 ug DNA	EUR 506

Cnih3 ORF Vector (Mouse) (pORF)
ORF041665	ABM	1.0 ug DNA	EUR 506

CNIH3 sgRNA CRISPR Lentivector set (Human)
K0475201	ABM	3 x 1.0 ug	EUR 339

Protein Cornichon Homolog 3 (CNIH3) Antibody
20-abx116808	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Protein Cornichon Homolog 3 (CNIH3) Antibody
abx029589-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Protein Cornichon Homolog 3 (CNIH3) Antibody
abx029589-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Protein Cornichon Homolog 3 (CNIH3) Antibody
20-abx302033	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Cornichon Homolog 3 (CNIH3) Antibody
abx231797-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Cnih3 sgRNA CRISPR Lentivector set (Mouse)
K3189301	ABM	3 x 1.0 ug	EUR 339

Cnih3 sgRNA CRISPR Lentivector set (Rat)
K6680401	ABM	3 x 1.0 ug	EUR 339

CNIH3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0475202	ABM	1.0 ug DNA	EUR 154

CNIH3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0475203	ABM	1.0 ug DNA	EUR 154

CNIH3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0475204	ABM	1.0 ug DNA	EUR 154

Protein Cornichon Homolog 3 (CNIH3) Antibody (HRP)
20-abx309952	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Cornichon Homolog 3 (CNIH3) Antibody (FITC)
20-abx309953	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Cornichon Homolog 3 (CNIH3) Antibody (Biotin)
20-abx309954	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cnih3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3189302	ABM	1.0 ug DNA	EUR 154

Cnih3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3189303	ABM	1.0 ug DNA	EUR 154

Cnih3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3189304	ABM	1.0 ug DNA	EUR 154

Cnih3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6680402	ABM	1.0 ug DNA	EUR 154

Cnih3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6680403	ABM	1.0 ug DNA	EUR 154

Cnih3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6680404	ABM	1.0 ug DNA	EUR 154

CNIH3 Protein Vector (Mouse) (pPB-C-His)
PV166650	ABM	500 ng	EUR 603

CNIH3 Protein Vector (Mouse) (pPB-N-His)
PV166651	ABM	500 ng	EUR 603

CNIH3 Protein Vector (Mouse) (pPM-C-HA)
PV166652	ABM	500 ng	EUR 603

CNIH3 Protein Vector (Mouse) (pPM-C-His)
PV166653	ABM	500 ng	EUR 603

CNIH3 Protein Vector (Mouse) (pPB-C-His)
PV166654	ABM	500 ng	EUR 603

CNIH3 Protein Vector (Mouse) (pPB-N-His)
PV166655	ABM	500 ng	EUR 603

CNIH3 Protein Vector (Mouse) (pPM-C-HA)
PV166656	ABM	500 ng	EUR 603

CNIH3 Protein Vector (Mouse) (pPM-C-His)
PV166657	ABM	500 ng	EUR 603

CNIH3 Protein Vector (Mouse) (pPB-C-His)
PV166658	ABM	500 ng	EUR 603

CNIH3 Protein Vector (Mouse) (pPB-N-His)
PV166659	ABM	500 ng	EUR 603

CNIH3 Protein Vector (Mouse) (pPM-C-HA)
PV166660	ABM	500 ng	EUR 603

CNIH3 Protein Vector (Mouse) (pPM-C-His)
PV166661	ABM	500 ng	EUR 603

CNIH3 Protein Vector (Human) (pPB-C-His)
PV009973	ABM	500 ng	EUR 329

CNIH3 Protein Vector (Human) (pPB-N-His)
PV009974	ABM	500 ng	EUR 329

CNIH3 Protein Vector (Human) (pPM-C-HA)
PV009975	ABM	500 ng	EUR 329

CNIH3 Protein Vector (Human) (pPM-C-His)
PV009976	ABM	500 ng	EUR 329

CNIH3 Protein Vector (Rat) (pPB-C-His)
PV260786	ABM	500 ng	EUR 603