Plastic Small Columns

CS-20 20/pk
EUR 115


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CS 2100

B5636-50 50 mg
EUR 1639

CS 2100

B5636-10 10 mg
EUR 438


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CS Antibody

43035-100ul 100ul
EUR 252

CS Antibody

32989-100ul 100ul
EUR 252

CS Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CS. Recognizes CS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

CS Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CS. Recognizes CS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

CS Conjugated Antibody

C43035 100ul
EUR 397

CS Conjugated Antibody

C32989 100ul
EUR 397

CS cloning plasmid

CSB-CL006031HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1203
  • Sequence: atgatgtatggtggcatgagaggcatgaagggattggtctatgaaacatcagttcttgatcctgatgagggcatccgtttccgaggctttagtatccctgaatgccagaaactgctacccaaggctaagggtggggaagaacccctgcctgagggcttattttggctgctggtaa
  • Show more
Description: A cloning plasmid for the CS gene.

CS cloning plasmid

CSB-CL006031HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1401
  • Sequence: atggctttacttactgcggccgcccggctcttgggaaccaagaatgcatcttgtcttgttcttgcagcccggcatgccagtgcttcctccacgaatttgaaagacatattggctgacctgatacctaaggagcaggccagaattaagactttcaggcagcaacatggcaagacgg
  • Show more
Description: A cloning plasmid for the CS gene.

CS Rabbit pAb

A5713-100ul 100 ul
EUR 308

CS Rabbit pAb

A5713-200ul 200 ul
EUR 459

CS Rabbit pAb

A5713-20ul 20 ul
EUR 183

CS Rabbit pAb

A5713-50ul 50 ul
EUR 223

CS Polyclonal Antibody

A52776 100 µg
EUR 570.55
Description: kits suitable for this type of research

CS Rabbit pAb

A17441-100ul 100 ul
EUR 308

CS Rabbit pAb

A17441-200ul 200 ul
EUR 459

CS Rabbit pAb

A17441-20ul 20 ul Ask for price

CS Rabbit pAb

A17441-50ul 50 ul Ask for price

Anti-CS antibody

STJ28281 100 µl
EUR 277
Description: The protein encoded by this gene is a Krebs tricarboxylic acid cycle enzyme that catalyzes the synthesis of citrate from oxaloacetate and acetyl coenzyme A. The enzyme is found in nearly all cells capable of oxidative metablism. This protein is nuclear encoded and transported into the mitochondrial matrix, where the mature form is found.

Anti-CS antibody

STJ119557 100 µl
EUR 277
Description: The protein encoded by this gene is a Krebs tricarboxylic acid cycle enzyme that catalyzes the synthesis of citrate from oxaloacetate and acetyl coenzyme A. The enzyme is found in nearly all cells capable of oxidative metablism. This protein is nuclear encoded and transported into the mitochondrial matrix, where the mature form is found.

Rat CS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CS ELISA Kit

EHC0836 96Tests
EUR 521

Human CS ELISA Kit

EHC0837 96Tests
EUR 521

Human CS ELISA Kit

ELA-E1661h 96 Tests
EUR 824


EGTC0836 96Tests
EUR 521


EGTC0837 96Tests
EUR 521

Canine CS ELISA Kit

ECC0836 96Tests
EUR 521

Canine CS ELISA Kit

ECC0837 96Tests
EUR 521

Chicken CS ELISA Kit

ECKC0836 96Tests
EUR 521

Bovine CS ELISA Kit

EBC0836 96Tests
EUR 521

Bovine CS ELISA Kit

EBC0837 96Tests
EUR 521

Anserini CS ELISA Kit

EAC0836 96Tests
EUR 521

Anserini CS ELISA Kit

EAC0837 96Tests
EUR 521


EF005993 96 Tests
EUR 689

Porcine CS ELISA Kit

EPC0836 96Tests
EUR 521

Porcine CS ELISA Kit

EPC0837 96Tests
EUR 521


ERC0836 96Tests
EUR 521


ERC0837 96Tests
EUR 521

Rabbit CS ELISA Kit

ERTC0836 96Tests
EUR 521

Rabbit CS ELISA Kit

ERTC0837 96Tests
EUR 521

Sheep CS ELISA Kit

ESC0836 96Tests
EUR 521

Mouse CS ELISA Kit

EMC0836 96Tests
EUR 521

Mouse CS ELISA Kit

EMC0837 96Tests
EUR 521

Monkey CS ELISA Kit

EMKC0836 96Tests
EUR 521

Citrate Synthase (CS) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Citrate Synthase (CS) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Citrate Synthase (CS) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Citrate Synthase (CS) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chondroitin Sulfate (CS) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Citrate Synthase (CS) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Citrate Synthase (CS) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chondroitin Sulfate (CS) Antibody

abx032658-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Chondroitin Sulfate (CS) Antibody

abx032658-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Chondroitin Sulfate (CS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Citrate Synthase (CS) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Malaria Cs Mosaic Protein

  • EUR 885.00
  • EUR 342.00
  • EUR 1609.00
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

Fibronectin CS-1 Peptide

  • EUR 384.00
  • EUR 592.00
  • EUR 300.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Citrate Synthase (CS) Antibody

abx231722-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Citrate Synthase (CS) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Citrate Synthase (CS) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human CS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CS protein (His tag)

80R-3939 100 ug
EUR 327
Description: Purified recombinant CS protein (His tag)

Recombinant Malaria Cs Mosaic

7-07090 100µg Ask for price

Recombinant Malaria Cs Mosaic

7-07091 500µg Ask for price

Recombinant Malaria Cs Mosaic

7-07092 1000µg Ask for price