CS

Clamp set for H3760 series
H3760-CS 1 PC
EUR 140.40
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

CS 2100
B5636-10 10 mg
EUR 438.00

CS 2100
B5636-50 50 mg
EUR 1639.00

CS Antibody
1-CSB-PA006031GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CS. Recognizes CS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

CS Antibody
1-CSB-PA006031LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CS. Recognizes CS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

CS Antibody
32989-100ul 100ul
EUR 252.00

CS Antibody
43035-100ul 100ul
EUR 252.00

CS siRNA
20-abx901306
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CS siRNA
20-abx912991
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CS siRNA
20-abx912992
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CS Conjugated Antibody
C43035 100ul
EUR 397.00

CS Conjugated Antibody
C32989 100ul
EUR 397.00

CS cloning plasmid
CSB-CL006031HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1203
  • Sequence: atgatgtatggtggcatgagaggcatgaagggattggtctatgaaacatcagttcttgatcctgatgagggcatccgtttccgaggctttagtatccctgaatgccagaaactgctacccaaggctaagggtggggaagaacccctgcctgagggcttattttggctgctggtaa
  • Show more
Description: A cloning plasmid for the CS gene.

CS cloning plasmid
CSB-CL006031HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1401
  • Sequence: atggctttacttactgcggccgcccggctcttgggaaccaagaatgcatcttgtcttgttcttgcagcccggcatgccagtgcttcctccacgaatttgaaagacatattggctgacctgatacctaaggagcaggccagaattaagactttcaggcagcaacatggcaagacgg
  • Show more
Description: A cloning plasmid for the CS gene.

CS Polyclonal Antibody
A52776 100 µg
EUR 570.55
Description: kits suitable for this type of research

CS Rabbit pAb
A5713-100ul 100 ul
EUR 308.00

CS Rabbit pAb
A5713-200ul 200 ul
EUR 459.00

CS Rabbit pAb
A5713-20ul 20 ul
EUR 183.00

CS Rabbit pAb
A5713-50ul 50 ul
EUR 223.00

CS Rabbit pAb
A17441-100ul 100 ul
EUR 308.00

CS Rabbit pAb
A17441-200ul 200 ul
EUR 459.00

CS Rabbit pAb
A17441-20ul 20 ul Ask for price

CS Rabbit pAb
A17441-50ul 50 ul Ask for price

Anti-CS antibody
STJ28281 100 µl
EUR 277.00
Description: The protein encoded by this gene is a Krebs tricarboxylic acid cycle enzyme that catalyzes the synthesis of citrate from oxaloacetate and acetyl coenzyme A. The enzyme is found in nearly all cells capable of oxidative metablism. This protein is nuclear encoded and transported into the mitochondrial matrix, where the mature form is found.

Anti-CS antibody
STJ119557 100 µl
EUR 277.00
Description: The protein encoded by this gene is a Krebs tricarboxylic acid cycle enzyme that catalyzes the synthesis of citrate from oxaloacetate and acetyl coenzyme A. The enzyme is found in nearly all cells capable of oxidative metablism. This protein is nuclear encoded and transported into the mitochondrial matrix, where the mature form is found.

Citrate Synthase (CS) Antibody
20-abx128582
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Citrate Synthase (CS) Antibody
20-abx129564
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Citrate Synthase (CS) Antibody
20-abx130290
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chondroitin Sulfate (CS) Antibody
20-abx130474
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Citrate Synthase (CS) Antibody
20-abx111685
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Citrate Synthase (CS) Antibody
20-abx109650
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat CS shRNA Plasmid
20-abx987590
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CS Antibody, HRP conjugated
1-CSB-PA006031LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CS. Recognizes CS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CS Antibody, FITC conjugated
1-CSB-PA006031LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CS. Recognizes CS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CS Antibody, Biotin conjugated
1-CSB-PA006031LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CS. Recognizes CS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Fibronectin CS-1 Peptide
5-01149 4 x 5mg Ask for price

Chondroitin Sulfate (CS) Antibody
20-abx004367
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chondroitin Sulfate (CS) Antibody
abx032658-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Chondroitin Sulfate (CS) Antibody
abx032658-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Citrate Synthase (CS) Antibody
20-abx141787
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Malaria Cs Mosaic Protein
20-abx260295
  • EUR 885.00
  • EUR 342.00
  • EUR 1609.00
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

Fibronectin CS-1 Peptide
20-abx265961
  • EUR 384.00
  • EUR 592.00
  • EUR 300.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Citrate Synthase (CS) Antibody
20-abx175871
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Citrate Synthase (CS) Antibody
20-abx171754
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Citrate Synthase (CS) Antibody
20-abx171755
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mouse CS shRNA Plasmid
20-abx969841
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CS shRNA Plasmid
20-abx951006
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Citrate Synthase (CS) Antibody
abx231722-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Recombinant Malaria Cs Mosaic
7-07090 100µg Ask for price

Recombinant Malaria Cs Mosaic
7-07091 500µg Ask for price

Recombinant Malaria Cs Mosaic
7-07092 1000µg Ask for price

CS protein (His tag)
80R-3939 100 ug
EUR 327.00
Description: Purified recombinant CS protein (His tag)

Sheep CS ELISA Kit
ESC0836 96Tests
EUR 521.00

Rat CS ELISA Kit
ERC0836 96Tests
EUR 521.00

Rat CS ELISA Kit
ERC0837 96Tests
EUR 521.00

Rabbit CS ELISA Kit
ERTC0836 96Tests
EUR 521.00

Rabbit CS ELISA Kit
ERTC0837 96Tests
EUR 521.00

Mouse CS ELISA Kit
EMC0836 96Tests
EUR 521.00

Mouse CS ELISA Kit
EMC0837 96Tests
EUR 521.00

Monkey CS ELISA Kit
EMKC0836 96Tests
EUR 521.00

Porcine CS ELISA Kit
EPC0836 96Tests
EUR 521.00

Porcine CS ELISA Kit
EPC0837 96Tests
EUR 521.00

Goat CS ELISA Kit
EGTC0836 96Tests
EUR 521.00

Goat CS ELISA Kit
EGTC0837 96Tests
EUR 521.00

Anserini CS ELISA Kit
EAC0836 96Tests
EUR 521.00

Anserini CS ELISA Kit
EAC0837 96Tests
EUR 521.00

Bovine CS ELISA Kit
EBC0836 96Tests
EUR 521.00

Bovine CS ELISA Kit
EBC0837 96Tests
EUR 521.00

Human CS ELISA Kit
ELA-E1661h 96 Tests
EUR 824.00

Human CS ELISA Kit
EHC0836 96Tests
EUR 521.00