DDIT3

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

DL-DDIT3-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human DNA Damage Inducible Transcript 3 (DDIT3)

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

DL-DDIT3-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human DNA Damage Inducible Transcript 3 (DDIT3)

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

DL-DDIT3-Mu-192 1 kit of 192 tests
EUR 1180.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse DNA Damage Inducible Transcript 3 (DDIT3)

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

DL-DDIT3-Mu-48 1 kit of 48 tests
EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse DNA Damage Inducible Transcript 3 (DDIT3)

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

DL-DDIT3-Mu-96 1 kit of 96 tests
EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse DNA Damage Inducible Transcript 3 (DDIT3)

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

DLR-DDIT3-Hu-48T 48T
EUR 517.00
  • Should the Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

DLR-DDIT3-Hu-96T 96T
EUR 673.00
  • Should the Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

DLR-DDIT3-Mu-48T 48T
EUR 527.00
  • Should the Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

DLR-DDIT3-Mu-96T 96T
EUR 688.00
  • Should the Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

RD-DDIT3-Hu-48Tests 48 Tests
EUR 521.00

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

RD-DDIT3-Hu-96Tests 96 Tests
EUR 723.00

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

RD-DDIT3-Mu-48Tests 48 Tests
EUR 533.00

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

RD-DDIT3-Mu-96Tests 96 Tests
EUR 740.00

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

RDR-DDIT3-Hu-48Tests 48 Tests
EUR 544.00

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

RDR-DDIT3-Hu-96Tests 96 Tests
EUR 756.00

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

RDR-DDIT3-Mu-48Tests 48 Tests
EUR 557.00

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit

RDR-DDIT3-Mu-96Tests 96 Tests
EUR 774.00

Ddit3/ Rat Ddit3 ELISA Kit

ELI-07661r 96 Tests
EUR 886.00

DDIT3 siRNA

20-abx913747
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DDIT3 siRNA

20-abx913748
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DDIT3 antibody

70R-16775 50 ul
EUR 435.00
Description: Rabbit polyclonal DDIT3 antibody

DDIT3 Antibody

49418-100ul 100ul
EUR 333.00

DDIT3 Antibody

49418-50ul 50ul
EUR 239.00

DDIT3 Antibody

1-CSB-PA001639
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

DDIT3 Antibody

1-CSB-PA001640
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

DDIT3 Antibody

CSB-PA071811-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF/ICC;WB:1:500-1:2000, IHC:1:50-1:200, IF/ICC:1:100-1:500

DDIT3 Antibody

CSB-PA071811-100ul 100ul
EUR 314.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF/ICC;WB:1:500-1:2000, IHC:1:50-1:200, IF/ICC:1:100-1:500

DDIT3 Antibody

32021-100ul 100ul
EUR 252.00

DDIT3 antibody

38967-100ul 100ul
EUR 252.00

DDIT3 Antibody

1-CSB-PA006589GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DDIT3 Antibody

1-CSB-PA006589LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DDIT3 antibody

PAab10045 100 ug
EUR 386.00

DDIT3 (pS30) Antibody

abx333032-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.

DDIT3 Polyclonal Antibody

A62398 100 µg
EUR 570.55
Description: reagents widely cited

Anti-DDIT3 Antibody

A1674-100
EUR 370.00

DDIT3 Conjugated Antibody

C49418 100ul
EUR 397.00

DDIT3 Conjugated Antibody

C32021 100ul
EUR 397.00

DDIT3 cloning plasmid

CSB-CL006589HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 510
  • Sequence: atggcagctgagtcattgcctttctcctttgggacactgtccagctgggagctggaagcctggtatgaggacctgcaagaggtcctgtcttcagatgaaaatgggggtacctatgtttcacctcctggaaatgaagaggaagaatcaaaaatcttcaccactcttgaccctgcttc
  • Show more
Description: A cloning plasmid for the DDIT3 gene.

anti- DDIT3 antibody

FNab10045 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: DNA-damage-inducible transcript 3
  • Uniprot ID: P35638
  • Gene ID: 1649
  • Research Area: Epigenetics, Stem Cells, Metabolism
Description: Antibody raised against DDIT3

pDONR223-DDIT3 Plasmid

PVTB00805 2 ug
EUR 356.00

pLVML- ECMV- DDIT3

PVT10223 2 ug
EUR 301.00

Anti-DDIT3 antibody

STJ116305 100 µl
EUR 277.00
Description: This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified.

Anti-DDIT3 antibody

STJ113090 100 µl
EUR 277.00
Description: This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified.

Anti-DDIT3 antibody

STJ113554 100 µl
EUR 277.00
Description: This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified.

Anti-DDIT3 antibody

STJ23356 100 µl
EUR 277.00
Description: This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified.

Anti-DDIT3 Antibody

STJ501130 100 µg
EUR 476.00

Mouse DDIT3 shRNA Plasmid

20-abx969970
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DDIT3 shRNA Plasmid

20-abx951162
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DDIT3 / CHOP Rabbit pAb

A0221-100ul 100 ul
EUR 308.00

DDIT3 / CHOP Rabbit pAb

A0221-200ul 200 ul
EUR 459.00

DDIT3 / CHOP Rabbit pAb

A0221-20ul 20 ul
EUR 183.00

DDIT3 / CHOP Rabbit pAb

A0221-50ul 50 ul
EUR 223.00

DDIT3 recombinant monoclonal antibody

A5462 100ul X 3
EUR 595.00
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human DDIT3 for WB,ELISA

DDIT3 / CHOP Rabbit pAb

A6504-100ul 100 ul
EUR 308.00

DDIT3 / CHOP Rabbit pAb

A6504-200ul 200 ul
EUR 459.00

DDIT3 / CHOP Rabbit pAb

A6504-20ul 20 ul
EUR 183.00

DDIT3 / CHOP Rabbit pAb

A6504-50ul 50 ul
EUR 223.00

DDIT3 / CHOP Rabbit pAb

A0854-100ul 100 ul
EUR 308.00

DDIT3 / CHOP Rabbit pAb

A0854-200ul 200 ul
EUR 459.00

DDIT3 / CHOP Rabbit pAb

A0854-20ul 20 ul
EUR 183.00

DDIT3 / CHOP Rabbit pAb

A0854-50ul 50 ul
EUR 223.00

DDIT3 / CHOP Rabbit pAb

A11346-100ul 100 ul
EUR 308.00

DDIT3 / CHOP Rabbit pAb

A11346-200ul 200 ul
EUR 459.00

DDIT3 / CHOP Rabbit pAb

A11346-20ul 20 ul
EUR 183.00

DDIT3 / CHOP Rabbit pAb

A11346-50ul 50 ul
EUR 223.00

Phospho-DDIT3 (Ser30) Antibody

CSB-PA799326-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-DDIT3 (Ser30). Recognizes Phospho-DDIT3 (Ser30) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-DDIT3 (Ser30) Antibody

CSB-PA799326-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-DDIT3 (Ser30). Recognizes Phospho-DDIT3 (Ser30) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

DDIT3 / CHOP Polyclonal Antibody

27243-100ul 100ul
EUR 252.00

DDIT3 / CHOP Polyclonal Antibody

27243-50ul 50ul
EUR 187.00

DDIT3 Antibody, HRP conjugated

1-CSB-PA006589LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA