DDIT3

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
DLR-DDIT3-Hu-96T 96T
EUR 673
  • Should the Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
DLR-DDIT3-Mu-48T 48T
EUR 527
  • Should the Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
DLR-DDIT3-Mu-96T 96T
EUR 688
  • Should the Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse DNA Damage Inducible Transcript 3 (DDIT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RDR-DDIT3-Hu-48Tests 48 Tests
EUR 544

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RDR-DDIT3-Hu-96Tests 96 Tests
EUR 756

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RDR-DDIT3-Mu-48Tests 48 Tests
EUR 557

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RDR-DDIT3-Mu-96Tests 96 Tests
EUR 774

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RD-DDIT3-Hu-48Tests 48 Tests
EUR 521

Human DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RD-DDIT3-Hu-96Tests 96 Tests
EUR 723

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RD-DDIT3-Mu-48Tests 48 Tests
EUR 533

Mouse DNA Damage Inducible Transcript 3 (DDIT3) ELISA Kit
RD-DDIT3-Mu-96Tests 96 Tests
EUR 740

Ddit3/ Rat Ddit3 ELISA Kit
ELI-07661r 96 Tests
EUR 886

DDIT3 antibody
70R-16775 50 ul
EUR 435
Description: Rabbit polyclonal DDIT3 antibody

DDIT3 Antibody
32021-100ul 100ul
EUR 252

DDIT3 antibody
38967-100ul 100ul
EUR 252

DDIT3 Antibody
49418-100ul 100ul
EUR 333

DDIT3 Antibody
49418-50ul 50ul
EUR 239

DDIT3 Antibody
1-CSB-PA001639
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

DDIT3 Antibody
1-CSB-PA001640
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

DDIT3 Antibody
CSB-PA071811-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF/ICC;WB:1:500-1:2000, IHC:1:50-1:200, IF/ICC:1:100-1:500

DDIT3 Antibody
CSB-PA071811-100ul 100ul
EUR 314
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF/ICC;WB:1:500-1:2000, IHC:1:50-1:200, IF/ICC:1:100-1:500

DDIT3 Antibody
1-CSB-PA006589GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DDIT3 Antibody
1-CSB-PA006589LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DDIT3 siRNA
20-abx913747
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DDIT3 siRNA
20-abx913748
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DDIT3 antibody
PAab10045 100 ug
EUR 386

DDIT3 Conjugated Antibody
C49418 100ul
EUR 397

DDIT3 Conjugated Antibody
C32021 100ul
EUR 397

DDIT3 (pS30) Antibody
abx333032-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

DDIT3 cloning plasmid
CSB-CL006589HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 510
  • Sequence: atggcagctgagtcattgcctttctcctttgggacactgtccagctgggagctggaagcctggtatgaggacctgcaagaggtcctgtcttcagatgaaaatgggggtacctatgtttcacctcctggaaatgaagaggaagaatcaaaaatcttcaccactcttgaccctgcttc
  • Show more
Description: A cloning plasmid for the DDIT3 gene.

DDIT3 Polyclonal Antibody
A62398 100 µg
EUR 570.55
Description: reagents widely cited

Anti-DDIT3 Antibody
A1674-100
EUR 370

anti- DDIT3 antibody
FNab10045 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: DNA-damage-inducible transcript 3
  • Uniprot ID: P35638
  • Gene ID: 1649
  • Research Area: Epigenetics, Stem Cells, Metabolism
Description: Antibody raised against DDIT3

pLVML- ECMV- DDIT3
PVT10223 2 ug
EUR 301

pDONR223-DDIT3 Plasmid
PVTB00805 2 ug
EUR 356

Anti-DDIT3 antibody
STJ113090 100 µl
EUR 277
Description: This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified.

Anti-DDIT3 antibody
STJ113554 100 µl
EUR 277
Description: This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified.

Anti-DDIT3 antibody
STJ116305 100 µl
EUR 277
Description: This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified.

Anti-DDIT3 Antibody
STJ501130 100 µg
EUR 476

Anti-DDIT3 antibody
STJ23356 100 µl
EUR 277
Description: This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified.

DDIT3 / CHOP Polyclonal Antibody
27243-100ul 100ul
EUR 252

DDIT3 / CHOP Polyclonal Antibody
27243-50ul 50ul
EUR 187

DDIT3 / CHOP Rabbit pAb
A0854-100ul 100 ul
EUR 308

DDIT3 / CHOP Rabbit pAb
A0854-200ul 200 ul
EUR 459

DDIT3 / CHOP Rabbit pAb
A0854-20ul 20 ul
EUR 183

DDIT3 / CHOP Rabbit pAb
A0854-50ul 50 ul
EUR 223

DDIT3 / CHOP Rabbit pAb
A11346-100ul 100 ul
EUR 308

DDIT3 / CHOP Rabbit pAb
A11346-200ul 200 ul
EUR 459

DDIT3 / CHOP Rabbit pAb
A11346-20ul 20 ul
EUR 183

DDIT3 / CHOP Rabbit pAb
A11346-50ul 50 ul
EUR 223

Phospho-DDIT3 (Ser30) Antibody
CSB-PA799326-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-DDIT3 (Ser30). Recognizes Phospho-DDIT3 (Ser30) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-DDIT3 (Ser30) Antibody
CSB-PA799326-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-DDIT3 (Ser30). Recognizes Phospho-DDIT3 (Ser30) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

DDIT3 Antibody, HRP conjugated
1-CSB-PA006589LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DDIT3 Antibody, FITC conjugated
1-CSB-PA006589LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DDIT3 Antibody, Biotin conjugated
1-CSB-PA006589LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDIT3. Recognizes DDIT3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DDIT3 / CHOP Rabbit pAb
A0221-100ul 100 ul
EUR 308

DDIT3 / CHOP Rabbit pAb
A0221-200ul 200 ul
EUR 459

DDIT3 / CHOP Rabbit pAb
A0221-20ul 20 ul
EUR 183

DDIT3 / CHOP Rabbit pAb
A0221-50ul 50 ul
EUR 223

Human DDIT3 ELISA Kit
ELA-E9115h 96 Tests
EUR 824

Mouse Ddit3 ELISA KIT
ELI-07660m 96 Tests
EUR 865

Human DDIT3 ELISA KIT
ELI-07662h 96 Tests
EUR 824

Bovine DDIT3 ELISA KIT
ELI-07663b 96 Tests
EUR 928

DDIT3 ELISA KIT|Human
EF006754 96 Tests
EUR 689

Polyclonal DDIT3 / CHOP Antibody
APR07530G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDIT3 / CHOP . This antibody is tested and proven to work in the following applications:

Phospho-DDIT3 (S30) Antibody
1-CSB-PA007699
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-DDIT3 (S30). Recognizes Phospho-DDIT3 (S30) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

Mouse DDIT3 shRNA Plasmid
20-abx969970
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DDIT3 shRNA Plasmid
20-abx951162
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DDIT3 / CHOP Rabbit pAb
A6504-100ul 100 ul
EUR 308

DDIT3 / CHOP Rabbit pAb
A6504-200ul 200 ul
EUR 459