DOHH

DOHH Antibody
1-CSB-PA880104LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DOHH. Recognizes DOHH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

DOHH siRNA
20-abx901557	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DOHH siRNA
20-abx914493	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DOHH siRNA
20-abx914494	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DOHH cloning plasmid
CSB-CL880104HU-10ug	Cusabio	10ug	EUR 364
Formulation: 10 μg plasmid + 200μl Glycerol Length: 909 Sequence: atggtgacggagcaggaggtggatgccatcgggcagacgctggtggaccccaagcagcccctgcaggcccgcttccgggcgctgttcacgctgcgtgggctcggcggcccaggcgccattgcatggatcagccaggccttcgatgacgattccgccctgctcaagcacgagctggc Show more
Description: A cloning plasmid for the DOHH gene.

DOHH Antibody, HRP conjugated
1-CSB-PA880104LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DOHH. Recognizes DOHH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DOHH Antibody, FITC conjugated
1-CSB-PA880104LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DOHH. Recognizes DOHH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DOHH Antibody, Biotin conjugated
1-CSB-PA880104LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DOHH. Recognizes DOHH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DOHH ELISA KIT|Human
EF004849	Lifescience Market	96 Tests	EUR 689

Rat DOHH shRNA Plasmid
20-abx989835	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse DOHH shRNA Plasmid
20-abx979525	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DOHH shRNA Plasmid
20-abx963112	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DOHH Recombinant Protein (Human)
RP009694	ABM	100 ug	Ask for price

DOHH Recombinant Protein (Rat)
RP198494	ABM	100 ug	Ask for price

DOHH Recombinant Protein (Mouse)
RP129821	ABM	100 ug	Ask for price

Dohh ORF Vector (Rat) (pORF)
ORF066166	ABM	1.0 ug DNA	EUR 506

DOHH ORF Vector (Human) (pORF)
ORF003232	ABM	1.0 ug DNA	EUR 95

Dohh ORF Vector (Mouse) (pORF)
ORF043275	ABM	1.0 ug DNA	EUR 506

Mouse Deoxyhypusine hydroxylase, Dohh ELISA KIT
ELI-09447m	Lifescience Market	96 Tests	EUR 865

Chicken Deoxyhypusine hydroxylase, DOHH ELISA KIT
ELI-09685c	Lifescience Market	96 Tests	EUR 928

Polyclonal DOHH antibody - N-terminal region
APR07612G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DOHH - N-terminal region. This antibody is tested and proven to work in the following applications:

Rat Deoxyhypusine hydroxylase (DOHH) ELISA Kit
abx391214-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Deoxyhypusine hydroxylase (DOHH) ELISA Kit
abx384787-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Deoxyhypusine hydroxylase (DOHH) ELISA Kit
abx389039-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Bovine Deoxyhypusine hydroxylase, DOHH ELISA KIT
ELI-47800b	Lifescience Market	96 Tests	EUR 928

Human Deoxyhypusine hydroxylase, DOHH ELISA KIT
ELI-47077h	Lifescience Market	96 Tests	EUR 824

DOHH sgRNA CRISPR Lentivector set (Human)
K0624801	ABM	3 x 1.0 ug	EUR 339

Dohh sgRNA CRISPR Lentivector set (Mouse)
K4945901	ABM	3 x 1.0 ug	EUR 339

Dohh sgRNA CRISPR Lentivector set (Rat)
K6649801	ABM	3 x 1.0 ug	EUR 339

DOHH sgRNA CRISPR Lentivector (Human) (Target 1)
K0624802	ABM	1.0 ug DNA	EUR 154

DOHH sgRNA CRISPR Lentivector (Human) (Target 2)
K0624803	ABM	1.0 ug DNA	EUR 154

DOHH sgRNA CRISPR Lentivector (Human) (Target 3)
K0624804	ABM	1.0 ug DNA	EUR 154

Dohh sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4945902	ABM	1.0 ug DNA	EUR 154

Dohh sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4945903	ABM	1.0 ug DNA	EUR 154

Dohh sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4945904	ABM	1.0 ug DNA	EUR 154

Dohh sgRNA CRISPR Lentivector (Rat) (Target 1)
K6649802	ABM	1.0 ug DNA	EUR 154

Dohh sgRNA CRISPR Lentivector (Rat) (Target 2)
K6649803	ABM	1.0 ug DNA	EUR 154

Dohh sgRNA CRISPR Lentivector (Rat) (Target 3)
K6649804	ABM	1.0 ug DNA	EUR 154

DOHH Protein Vector (Mouse) (pPB-C-His)
PV173098	ABM	500 ng	EUR 603

DOHH Protein Vector (Mouse) (pPB-N-His)
PV173099	ABM	500 ng	EUR 603

DOHH Protein Vector (Mouse) (pPM-C-HA)
PV173100	ABM	500 ng	EUR 603

DOHH Protein Vector (Mouse) (pPM-C-His)
PV173101	ABM	500 ng	EUR 603

DOHH Protein Vector (Rat) (pPB-C-His)
PV264662	ABM	500 ng	EUR 603

DOHH Protein Vector (Rat) (pPB-N-His)
PV264663	ABM	500 ng	EUR 603

DOHH Protein Vector (Rat) (pPM-C-HA)
PV264664	ABM	500 ng	EUR 603

DOHH Protein Vector (Rat) (pPM-C-His)
PV264665	ABM	500 ng	EUR 603

DOHH Protein Vector (Human) (pPB-C-His)
PV012925	ABM	500 ng	EUR 329

DOHH Protein Vector (Human) (pPB-N-His)
PV012926	ABM	500 ng	EUR 329

DOHH Protein Vector (Human) (pPM-C-HA)
PV012927	ABM	500 ng	EUR 329

DOHH Protein Vector (Human) (pPM-C-His)
PV012928	ABM	500 ng	EUR 329

Human Deoxyhypusine Hydroxylase/Monooxygenase(DOHH)ELISA Kit
QY-E01153	Qayee Biotechnology	96T	EUR 361

Dohh 3'UTR GFP Stable Cell Line
TU155326	ABM	1.0 ml	Ask for price

Dohh 3'UTR Luciferase Stable Cell Line
TU105326	ABM	1.0 ml	Ask for price

Dohh 3'UTR Luciferase Stable Cell Line
TU203576	ABM	1.0 ml	Ask for price

Dohh 3'UTR GFP Stable Cell Line
TU253576	ABM	1.0 ml	Ask for price

DOHH 3'UTR GFP Stable Cell Line
TU056243	ABM	1.0 ml	EUR 1394

DOHH 3'UTR Luciferase Stable Cell Line
TU006243	ABM	1.0 ml	EUR 1394

Dohh ELISA Kit| Rat Deoxyhypusine hydroxylase ELISA Kit
EF018568	Lifescience Market	96 Tests	EUR 689

Dohh ELISA Kit| Mouse Deoxyhypusine hydroxylase ELISA Kit
EF014668	Lifescience Market	96 Tests	EUR 689

DOHH ELISA Kit| Bovine Deoxyhypusine hydroxylase ELISA Kit
EF011303	Lifescience Market	96 Tests	EUR 689

DOHH ELISA Kit| chicken Deoxyhypusine hydroxylase ELISA Kit
EF012279	Lifescience Market	96 Tests	EUR 689

DOHH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV663037	ABM	1.0 ug DNA	EUR 514

DOHH Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV663041	ABM	1.0 ug DNA	EUR 514

DOHH Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV663042	ABM	1.0 ug DNA	EUR 514

DOHH sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0624805	ABM	3 x 1.0 ug	EUR 376

Dohh sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4945905	ABM	3 x 1.0 ug	EUR 376

Dohh sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6649805	ABM	3 x 1.0 ug	EUR 376

DOHH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0624806	ABM	1.0 ug DNA	EUR 167

DOHH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0624807	ABM	1.0 ug DNA	EUR 167

DOHH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0624808	ABM	1.0 ug DNA	EUR 167