DOHH

DOHH siRNA

20-abx901557
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DOHH siRNA

20-abx914493
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DOHH siRNA

20-abx914494
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DOHH Antibody

1-CSB-PA880104LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DOHH. Recognizes DOHH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

DOHH cloning plasmid

CSB-CL880104HU-10ug 10ug
EUR 364
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 909
  • Sequence: atggtgacggagcaggaggtggatgccatcgggcagacgctggtggaccccaagcagcccctgcaggcccgcttccgggcgctgttcacgctgcgtgggctcggcggcccaggcgccattgcatggatcagccaggccttcgatgacgattccgccctgctcaagcacgagctggc
  • Show more
Description: A cloning plasmid for the DOHH gene.

Mouse DOHH shRNA Plasmid

20-abx979525
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat DOHH shRNA Plasmid

20-abx989835
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DOHH shRNA Plasmid

20-abx963112
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DOHH ELISA KIT|Human

EF004849 96 Tests
EUR 689

DOHH Antibody, HRP conjugated

1-CSB-PA880104LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DOHH. Recognizes DOHH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DOHH Antibody, FITC conjugated

1-CSB-PA880104LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DOHH. Recognizes DOHH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DOHH Antibody, Biotin conjugated

1-CSB-PA880104LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DOHH. Recognizes DOHH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DOHH Recombinant Protein (Human)

RP009694 100 ug Ask for price

DOHH Recombinant Protein (Rat)

RP198494 100 ug Ask for price

DOHH Recombinant Protein (Mouse)

RP129821 100 ug Ask for price

DOHH ORF Vector (Human) (pORF)

ORF003232 1.0 ug DNA
EUR 95

Dohh ORF Vector (Rat) (pORF)

ORF066166 1.0 ug DNA
EUR 506

Dohh ORF Vector (Mouse) (pORF)

ORF043275 1.0 ug DNA
EUR 506

Polyclonal DOHH antibody - N-terminal region

APR07612G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DOHH - N-terminal region. This antibody is tested and proven to work in the following applications:

Mouse Deoxyhypusine hydroxylase, Dohh ELISA KIT

ELI-09447m 96 Tests
EUR 865

Chicken Deoxyhypusine hydroxylase, DOHH ELISA KIT

ELI-09685c 96 Tests
EUR 928

Human Deoxyhypusine hydroxylase, DOHH ELISA KIT

ELI-47077h 96 Tests
EUR 824

Bovine Deoxyhypusine hydroxylase, DOHH ELISA KIT

ELI-47800b 96 Tests
EUR 928

DOHH sgRNA CRISPR Lentivector set (Human)

K0624801 3 x 1.0 ug
EUR 339

Human Deoxyhypusine hydroxylase (DOHH) ELISA Kit

abx384787-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Deoxyhypusine hydroxylase (DOHH) ELISA Kit

abx389039-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Deoxyhypusine hydroxylase (DOHH) ELISA Kit

abx391214-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dohh sgRNA CRISPR Lentivector set (Mouse)

K4945901 3 x 1.0 ug
EUR 339

Dohh sgRNA CRISPR Lentivector set (Rat)

K6649801 3 x 1.0 ug
EUR 339

DOHH sgRNA CRISPR Lentivector (Human) (Target 1)

K0624802 1.0 ug DNA
EUR 154

DOHH sgRNA CRISPR Lentivector (Human) (Target 2)

K0624803 1.0 ug DNA
EUR 154

DOHH sgRNA CRISPR Lentivector (Human) (Target 3)

K0624804 1.0 ug DNA
EUR 154

Dohh sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4945902 1.0 ug DNA
EUR 154

Dohh sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4945903 1.0 ug DNA
EUR 154

Dohh sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4945904 1.0 ug DNA
EUR 154

Dohh sgRNA CRISPR Lentivector (Rat) (Target 1)

K6649802 1.0 ug DNA
EUR 154

Dohh sgRNA CRISPR Lentivector (Rat) (Target 2)

K6649803 1.0 ug DNA
EUR 154

Dohh sgRNA CRISPR Lentivector (Rat) (Target 3)

K6649804 1.0 ug DNA
EUR 154

DOHH Protein Vector (Mouse) (pPB-C-His)

PV173098 500 ng
EUR 603

DOHH Protein Vector (Mouse) (pPB-N-His)

PV173099 500 ng
EUR 603

DOHH Protein Vector (Mouse) (pPM-C-HA)

PV173100 500 ng
EUR 603

DOHH Protein Vector (Mouse) (pPM-C-His)

PV173101 500 ng
EUR 603

Human Deoxyhypusine Hydroxylase/Monooxygenase(DOHH)ELISA Kit

QY-E01153 96T
EUR 361

DOHH Protein Vector (Human) (pPB-C-His)

PV012925 500 ng
EUR 329

DOHH Protein Vector (Human) (pPB-N-His)

PV012926 500 ng
EUR 329

DOHH Protein Vector (Human) (pPM-C-HA)

PV012927 500 ng
EUR 329

DOHH Protein Vector (Human) (pPM-C-His)

PV012928 500 ng
EUR 329

DOHH Protein Vector (Rat) (pPB-C-His)

PV264662 500 ng
EUR 603

DOHH Protein Vector (Rat) (pPB-N-His)

PV264663 500 ng
EUR 603

DOHH Protein Vector (Rat) (pPM-C-HA)

PV264664 500 ng
EUR 603

DOHH Protein Vector (Rat) (pPM-C-His)

PV264665 500 ng
EUR 603

Dohh 3'UTR Luciferase Stable Cell Line

TU203576 1.0 ml Ask for price

Dohh 3'UTR GFP Stable Cell Line

TU155326 1.0 ml Ask for price

DOHH 3'UTR Luciferase Stable Cell Line

TU006243 1.0 ml
EUR 1394

Dohh 3'UTR Luciferase Stable Cell Line

TU105326 1.0 ml Ask for price

DOHH 3'UTR GFP Stable Cell Line

TU056243 1.0 ml
EUR 1394

Dohh 3'UTR GFP Stable Cell Line

TU253576 1.0 ml Ask for price

Dohh ELISA Kit| Rat Deoxyhypusine hydroxylase ELISA Kit

EF018568 96 Tests
EUR 689

Dohh ELISA Kit| Mouse Deoxyhypusine hydroxylase ELISA Kit

EF014668 96 Tests
EUR 689

DOHH ELISA Kit| chicken Deoxyhypusine hydroxylase ELISA Kit

EF012279 96 Tests
EUR 689

DOHH ELISA Kit| Bovine Deoxyhypusine hydroxylase ELISA Kit

EF011303 96 Tests
EUR 689

DOHH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV663037 1.0 ug DNA
EUR 514

DOHH Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV663041 1.0 ug DNA
EUR 514

DOHH Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV663042 1.0 ug DNA
EUR 514

DOHH sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0624805 3 x 1.0 ug
EUR 376

Dohh sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4945905 3 x 1.0 ug
EUR 376

Dohh sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6649805 3 x 1.0 ug
EUR 376

DOHH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0624806 1.0 ug DNA
EUR 167

DOHH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0624807 1.0 ug DNA
EUR 167

DOHH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0624808 1.0 ug DNA
EUR 167