DOLK

DOLK siRNA

20-abx914510
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DOLK cloning plasmid

CSB-CL007114HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1617
  • Sequence: atgacccgagagtgcccatctccggccccggggcctggggctccgctgagtggatcggtgctggcagaggcggcagtagtgtttgcagtggtgctgagcatccacgcaaccgtatgggaccgatactcgtggtgcgccgtggccctcgcagtgcaggccttctacgtccaataca
  • Show more
Description: A cloning plasmid for the DOLK gene.

Human DOLK shRNA Plasmid

20-abx957807
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DOLK shRNA Plasmid

20-abx981583
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Dolichol Kinase (DOLK) Antibody

abx034128-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Dolichol Kinase (DOLK) Antibody

abx034128-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

DOLK Recombinant Protein (Human)

RP009712 100 ug Ask for price

DOLK Recombinant Protein (Rat)

RP198515 100 ug Ask for price

DOLK Recombinant Protein (Mouse)

RP129848 100 ug Ask for price

DOLK ORF Vector (Human) (pORF)

ORF003238 1.0 ug DNA
EUR 95.00

Dolk ORF Vector (Rat) (pORF)

ORF066173 1.0 ug DNA
EUR 506.00

Dolk ORF Vector (Mouse) (pORF)

ORF043284 1.0 ug DNA
EUR 506.00

Human Dolichol Kinase (DOLK)ELISA Kit

201-12-2412 96 tests
EUR 440.00
  • This Dolichol Kinase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Rat Dolichol Kinase(DOLK)ELISA Kit

GA-E0936RT-48T 48T
EUR 317.00

Rat Dolichol Kinase(DOLK)ELISA Kit

GA-E0936RT-96T 96T
EUR 496.00

DOLK sgRNA CRISPR Lentivector set (Human)

K0625601 3 x 1.0 ug
EUR 339.00

Bovine Dolichol kinase, DOLK ELISA KIT

ELI-09222b 96 Tests
EUR 928.00

Human Dolichol kinase, DOLK ELISA KIT

ELI-46903h 96 Tests
EUR 824.00

Mouse Dolichol kinase, Dolk ELISA KIT

ELI-25991m 96 Tests
EUR 865.00

Dolk sgRNA CRISPR Lentivector set (Mouse)

K4265401 3 x 1.0 ug
EUR 339.00

Dolk sgRNA CRISPR Lentivector set (Rat)

K6332201 3 x 1.0 ug
EUR 339.00

Human Dolichol Kinase(DOLK)ELISA Kit

QY-E03619 96T
EUR 400.00

Mouse Dolichol Kinase(DOLK)ELISA Kit

QY-E20483 96T
EUR 361.00

Rat Dolichol Kinase(DOLK)ELISA Kit

QY-E10716 96T
EUR 361.00

DOLK Protein Vector (Human) (pPB-C-His)

PV012949 500 ng
EUR 329.00

DOLK Protein Vector (Human) (pPB-N-His)

PV012950 500 ng
EUR 329.00

DOLK Protein Vector (Human) (pPM-C-HA)

PV012951 500 ng
EUR 329.00

DOLK Protein Vector (Human) (pPM-C-His)

PV012952 500 ng
EUR 329.00

DOLK sgRNA CRISPR Lentivector (Human) (Target 1)

K0625602 1.0 ug DNA
EUR 154.00

DOLK sgRNA CRISPR Lentivector (Human) (Target 2)

K0625603 1.0 ug DNA
EUR 154.00

DOLK sgRNA CRISPR Lentivector (Human) (Target 3)

K0625604 1.0 ug DNA
EUR 154.00

Dolk sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4265402 1.0 ug DNA
EUR 154.00

Dolk sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4265403 1.0 ug DNA
EUR 154.00

Dolk sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4265404 1.0 ug DNA
EUR 154.00

Dolk sgRNA CRISPR Lentivector (Rat) (Target 1)

K6332202 1.0 ug DNA
EUR 154.00

Dolk sgRNA CRISPR Lentivector (Rat) (Target 2)

K6332203 1.0 ug DNA
EUR 154.00

Dolk sgRNA CRISPR Lentivector (Rat) (Target 3)

K6332204 1.0 ug DNA
EUR 154.00

DOLK Protein Vector (Mouse) (pPB-C-His)

PV173134 500 ng
EUR 603.00

DOLK Protein Vector (Mouse) (pPB-N-His)

PV173135 500 ng
EUR 603.00

DOLK Protein Vector (Mouse) (pPM-C-HA)

PV173136 500 ng
EUR 603.00

DOLK Protein Vector (Mouse) (pPM-C-His)

PV173137 500 ng
EUR 603.00

DOLK 3'UTR Luciferase Stable Cell Line

TU006251 1.0 ml
EUR 1394.00

DOLK 3'UTR GFP Stable Cell Line

TU056251 1.0 ml
EUR 1394.00

DOLK Protein Vector (Rat) (pPB-C-His)

PV264690 500 ng
EUR 603.00

DOLK Protein Vector (Rat) (pPB-N-His)

PV264691 500 ng
EUR 603.00

DOLK Protein Vector (Rat) (pPM-C-HA)

PV264692 500 ng
EUR 603.00

DOLK Protein Vector (Rat) (pPM-C-His)

PV264693 500 ng
EUR 603.00

Dolk 3'UTR GFP Stable Cell Line

TU253583 1.0 ml Ask for price

Dolk 3'UTR Luciferase Stable Cell Line

TU203583 1.0 ml Ask for price

Dolk 3'UTR GFP Stable Cell Line

TU155334 1.0 ml Ask for price

Dolk 3'UTR Luciferase Stable Cell Line

TU105334 1.0 ml Ask for price

DOLK sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0625605 3 x 1.0 ug
EUR 376.00

Dolk sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4265405 3 x 1.0 ug
EUR 376.00

Dolk sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6332205 3 x 1.0 ug
EUR 376.00

DOLK sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0625606 1.0 ug DNA
EUR 167.00

DOLK sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0625607 1.0 ug DNA
EUR 167.00

DOLK sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0625608 1.0 ug DNA
EUR 167.00

Dolk sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4265406 1.0 ug DNA
EUR 167.00

Dolk sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4265407 1.0 ug DNA
EUR 167.00

Dolk sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4265408 1.0 ug DNA
EUR 167.00

Dolk sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6332206 1.0 ug DNA
EUR 167.00

Dolk sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6332207 1.0 ug DNA
EUR 167.00

Dolk sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6332208 1.0 ug DNA
EUR 167.00