DPM3

DPM3 siRNA

20-abx914557
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DPM3 cloning plasmid

CSB-CL879075HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: ATGCTCTCCGTGGGCGGGCTTCGGTTGAGTTTGGTCCGCTTTTCCTTTCTGCTCCTCAGGGGAGCATTGCTTCCTTCTCTCGCAGTGACCATGACGAAATTAGCGCAGTGGCTTTGGGGACTAGCGATCCTGGGCTCCACCTGGGTGGCCCTGACCACGGGAGCCTTGGGCCTGGA
  • Show more
Description: A cloning plasmid for the DPM3 gene.

Anti-DPM3 antibody

STJ71741 100 µg
EUR 359.00

Mouse DPM3 shRNA Plasmid

20-abx976661
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DPM3 shRNA Plasmid

20-abx960039
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Dpm3 ELISA KIT

ELI-25997m 96 Tests
EUR 865.00

Human DPM3 ELISA KIT

ELI-26852h 96 Tests
EUR 824.00

Bovine DPM3 ELISA KIT

ELI-09396b 96 Tests
EUR 928.00

DPM3 Recombinant Protein (Human)

RP038623 100 ug Ask for price

pCMV-SPORT6-DPM3 Plasmid

PVT16338 2 ug
EUR 325.00

DPM3 Recombinant Protein (Rat)

RP198587 100 ug Ask for price

DPM3 Recombinant Protein (Mouse)

RP129929 100 ug Ask for price

Polyclonal DPM3 Antibody (internal region)

AMM06949G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DPM3 (internal region). This antibody is tested and proven to work in the following applications:

DPM3 ORF Vector (Human) (pORF)

ORF012875 1.0 ug DNA
EUR 354.00

Dpm3 ORF Vector (Mouse) (pORF)

ORF043311 1.0 ug DNA
EUR 506.00

Dpm3 ORF Vector (Rat) (pORF)

ORF066197 1.0 ug DNA
EUR 506.00

DPM3 sgRNA CRISPR Lentivector set (Human)

K0627801 3 x 1.0 ug
EUR 339.00

Dpm3 sgRNA CRISPR Lentivector set (Mouse)

K4812701 3 x 1.0 ug
EUR 339.00

Dpm3 sgRNA CRISPR Lentivector set (Rat)

K6180201 3 x 1.0 ug
EUR 339.00

Dolichol-Phosphate Mannosyltransferase Subunit 3 (DPM3) Antibody

abx432621-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

DPM3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0627802 1.0 ug DNA
EUR 154.00

DPM3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0627803 1.0 ug DNA
EUR 154.00

DPM3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0627804 1.0 ug DNA
EUR 154.00

Dpm3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4812702 1.0 ug DNA
EUR 154.00

Dpm3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4812703 1.0 ug DNA
EUR 154.00

Dpm3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4812704 1.0 ug DNA
EUR 154.00

Dpm3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6180202 1.0 ug DNA
EUR 154.00

Dpm3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6180203 1.0 ug DNA
EUR 154.00

Dpm3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6180204 1.0 ug DNA
EUR 154.00

DPM3 Protein Vector (Rat) (pPB-C-His)

PV264786 500 ng
EUR 603.00

DPM3 Protein Vector (Rat) (pPB-N-His)

PV264787 500 ng
EUR 603.00

DPM3 Protein Vector (Rat) (pPM-C-HA)

PV264788 500 ng
EUR 603.00

DPM3 Protein Vector (Rat) (pPM-C-His)

PV264789 500 ng
EUR 603.00

DPM3 Protein Vector (Mouse) (pPB-C-His)

PV173242 500 ng
EUR 603.00

DPM3 Protein Vector (Mouse) (pPB-N-His)

PV173243 500 ng
EUR 603.00

DPM3 Protein Vector (Mouse) (pPM-C-HA)

PV173244 500 ng
EUR 603.00

DPM3 Protein Vector (Mouse) (pPM-C-His)

PV173245 500 ng
EUR 603.00

DPM3 Protein Vector (Human) (pPB-C-His)

PV051497 500 ng
EUR 481.00

DPM3 Protein Vector (Human) (pPB-N-His)

PV051498 500 ng
EUR 481.00

DPM3 Protein Vector (Human) (pPM-C-HA)

PV051499 500 ng
EUR 481.00

DPM3 Protein Vector (Human) (pPM-C-His)

PV051500 500 ng
EUR 481.00

Dpm3 3'UTR GFP Stable Cell Line

TU155359 1.0 ml Ask for price

DPM3 3'UTR Luciferase Stable Cell Line

TU006275 1.0 ml
EUR 1394.00

Dpm3 3'UTR Luciferase Stable Cell Line

TU203607 1.0 ml Ask for price

Dpm3 3'UTR Luciferase Stable Cell Line

TU105359 1.0 ml Ask for price

DPM3 3'UTR GFP Stable Cell Line

TU056275 1.0 ml
EUR 1394.00

Dpm3 3'UTR GFP Stable Cell Line

TU253607 1.0 ml Ask for price

DPM3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV656257 1.0 ug DNA
EUR 514.00

DPM3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV656261 1.0 ug DNA
EUR 514.00

DPM3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV656262 1.0 ug DNA
EUR 514.00

Recombinant Schizosaccharomyces Pombe dpm3 Protein (aa 1-90)

VAng-Yyj5650-inquire inquire Ask for price
Description: Schizosaccharomyces Pombe (strain 972 / ATCC 24843) (Fission yeast) Dolichol-phosphate mannosyltransferase subunit 3 (dpm3), recombinant protein.

DPM3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0627805 3 x 1.0 ug
EUR 376.00

Dpm3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4812705 3 x 1.0 ug
EUR 376.00

Dpm3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6180205 3 x 1.0 ug
EUR 376.00

DPM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0627806 1.0 ug DNA
EUR 167.00

DPM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0627807 1.0 ug DNA
EUR 167.00

DPM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0627808 1.0 ug DNA
EUR 167.00

DPM3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV656258 1.0 ug DNA
EUR 514.00

DPM3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV656259 1.0 ug DNA
EUR 572.00

DPM3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV656260 1.0 ug DNA
EUR 572.00

Dpm3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4812706 1.0 ug DNA
EUR 167.00

Dpm3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4812707 1.0 ug DNA
EUR 167.00

Dpm3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4812708 1.0 ug DNA
EUR 167.00

Dpm3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6180206 1.0 ug DNA
EUR 167.00

Dpm3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6180207 1.0 ug DNA
EUR 167.00

Dpm3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6180208 1.0 ug DNA
EUR 167.00