EEF1B2 antibody

39022-100ul 100ul
EUR 252

EEF1B2 Antibody

43073-100ul 100ul
EUR 252

EEF1B2 Antibody

1-CSB-PA004634
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EEF1B2. Recognizes EEF1B2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EEF1B2 Antibody

1-CSB-PA335050DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1B2. Recognizes EEF1B2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EEF1B2 Antibody

1-CSB-PA335050DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1B2. Recognizes EEF1B2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EEF1B2 antibody

70R-49683 100 ul
EUR 244
Description: Purified Polyclonal EEF1B2 antibody

EEF1B2 siRNA

20-abx914978
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EEF1B2 Blocking Peptide

33R-9624 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF1B2 antibody, catalog no. 70R-2143

EEF1B2 Blocking Peptide

20-abx062558
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

EEF1B2 Conjugated Antibody

C43073 100ul
EUR 397

EEF1B2 Conjugated Antibody

C39022 100ul
EUR 397

EEF1B2 cloning plasmid

CSB-CL335050HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 678
  • Sequence: atgggtttcggagacctgaaaagccctgccggcctccaggtgctcaacgattacctggcggacaagagctacatcgaggggtatgtgccatcacaagcagatgtggcagtatttgaagccgtgtccagcccaccgcctgccgacttgtgtcatgccctacgttggtataatcacat
  • Show more
Description: A cloning plasmid for the EEF1B2 gene.

EEF1B2 cloning plasmid

CSB-CL335050HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 678
  • Sequence: atgggtttcggagacctgaaaagccctgccggcctccaggtgctcaacgattacctggcggacaagagctacatcgaggggtatgtgccatcacaagcagatgtggcagtatttgaagccgtgtccagcccaccgcctgccgacttgtgtcatgccctacgttggtataatcacat
  • Show more
Description: A cloning plasmid for the EEF1B2 gene.

anti- EEF1B2 antibody

FNab02643 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: eukaryotic translation elongation factor 1 beta 2
  • Uniprot ID: P24534
  • Gene ID: 1933
  • Research Area: Cancer, Metabolism
Description: Antibody raised against EEF1B2

anti- EEF1B2 antibody

FNab02644 100µg
EUR 505.25
  • Immunogen: eukaryotic translation elongation factor 1 beta 2
  • Uniprot ID: P24534
  • Gene ID: 1933
  • Research Area: Cancer, Metabolism
Description: Antibody raised against EEF1B2

anti- EEF1B2 antibody

FNab02645 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:4000
  • IF: 1:50-1:500
  • Immunogen: eukaryotic translation elongation factor 1 beta 2
  • Uniprot ID: P24534
  • Gene ID: 1933
  • Research Area: Cancer, Metabolism
Description: Antibody raised against EEF1B2

Anti-EEF1B2 antibody

PAab02643 100 ug
EUR 355

Anti-EEF1B2 antibody

PAab02644 100 ug
EUR 355

Anti-EEF1B2 antibody

STJ28663 100 µl
EUR 413
Description: This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5' UTR.

Anti-eEF1B2 (3A5)

YF-MA12778 100 ug
EUR 363
Description: Mouse monoclonal to eEF1B2

EEF1B2 protein (His tag)

80R-1704 10 ug
EUR 305
Description: Purified recombinant Human EEF1B2 protein

EEF1B2 ELISA KIT|Human

EF009297 96 Tests
EUR 689

Human EEF1B2 shRNA Plasmid

20-abx951334
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EEF1B2 Recombinant Protein (Human)

RP010198 100 ug Ask for price

EEF1B2 Recombinant Protein (Human)

RP010201 100 ug Ask for price

EEF1B2 Recombinant Protein (Rat)

RP199085 100 ug Ask for price

EEF1B2 Recombinant Protein (Mouse)

RP130901 100 ug Ask for price

[KO Validated] EEF1B2 Rabbit pAb

A6580-100ul 100 ul
EUR 410

[KO Validated] EEF1B2 Rabbit pAb

A6580-200ul 200 ul
EUR 571

[KO Validated] EEF1B2 Rabbit pAb

A6580-20ul 20 ul
EUR 221

[KO Validated] EEF1B2 Rabbit pAb

A6580-50ul 50 ul
EUR 287

Eef1b2 ORF Vector (Rat) (pORF)

ORF066363 1.0 ug DNA
EUR 506

EEF1B2 ORF Vector (Human) (pORF)

ORF003400 1.0 ug DNA
EUR 95

EEF1B2 ORF Vector (Human) (pORF)

ORF003401 1.0 ug DNA
EUR 95

Eef1b2 ORF Vector (Mouse) (pORF)

ORF043635 1.0 ug DNA
EUR 506

Human Elongation factor 1-beta (EEF1B2)

1-CSB-EP335050HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 51.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 1-beta(EEF1B2) expressed in E.coli

Eef1b2 sgRNA CRISPR Lentivector set (Mouse)

K4892201 3 x 1.0 ug
EUR 339

EEF1B2 sgRNA CRISPR Lentivector set (Human)

K0656701 3 x 1.0 ug
EUR 339

Eef1b2 sgRNA CRISPR Lentivector set (Rat)

K6406801 3 x 1.0 ug
EUR 339

Eef1b2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4892202 1.0 ug DNA
EUR 154

Eef1b2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4892203 1.0 ug DNA
EUR 154

Eef1b2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4892204 1.0 ug DNA
EUR 154

EEF1B2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0656702 1.0 ug DNA
EUR 154

EEF1B2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0656703 1.0 ug DNA
EUR 154

EEF1B2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0656704 1.0 ug DNA
EUR 154

Eef1b2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6406802 1.0 ug DNA
EUR 154

Eef1b2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6406803 1.0 ug DNA
EUR 154

Eef1b2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6406804 1.0 ug DNA
EUR 154

EEF1B2 Protein Vector (Mouse) (pPB-C-His)

PV174538 500 ng
EUR 603

EEF1B2 Protein Vector (Mouse) (pPB-N-His)

PV174539 500 ng
EUR 603

EEF1B2 Protein Vector (Mouse) (pPM-C-HA)

PV174540 500 ng
EUR 603

EEF1B2 Protein Vector (Mouse) (pPM-C-His)

PV174541 500 ng
EUR 603

EEF1B2 Protein Vector (Rat) (pPB-C-His)

PV265450 500 ng
EUR 603

EEF1B2 Protein Vector (Rat) (pPB-N-His)

PV265451 500 ng
EUR 603

EEF1B2 Protein Vector (Rat) (pPM-C-HA)

PV265452 500 ng
EUR 603

EEF1B2 Protein Vector (Rat) (pPM-C-His)

PV265453 500 ng
EUR 603

EEF1B2 Protein Vector (Human) (pPB-C-His)

PV013597 500 ng
EUR 329

EEF1B2 Protein Vector (Human) (pPB-N-His)

PV013598 500 ng
EUR 329

EEF1B2 Protein Vector (Human) (pPM-C-HA)

PV013599 500 ng
EUR 329

EEF1B2 Protein Vector (Human) (pPM-C-His)

PV013600 500 ng
EUR 329

EEF1B2 Protein Vector (Human) (pPB-C-His)

PV013601 500 ng
EUR 329

EEF1B2 Protein Vector (Human) (pPB-N-His)

PV013602 500 ng
EUR 329

EEF1B2 Protein Vector (Human) (pPM-C-HA)

PV013603 500 ng
EUR 329

EEF1B2 Protein Vector (Human) (pPM-C-His)

PV013604 500 ng
EUR 329

Eef1b2 3'UTR GFP Stable Cell Line

TU155611 1.0 ml Ask for price

Eef1b2 3'UTR Luciferase Stable Cell Line

TU105611 1.0 ml Ask for price

Eef1b2 3'UTR Luciferase Stable Cell Line

TU203789 1.0 ml Ask for price

Eef1b2 3'UTR GFP Stable Cell Line

TU253789 1.0 ml Ask for price

EEF1B2 3'UTR GFP Stable Cell Line

TU056618 1.0 ml
EUR 1521

EEF1B2 3'UTR Luciferase Stable Cell Line

TU006618 1.0 ml
EUR 1521