EIF3A

EIF3A siRNA
20-abx901678	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF3A Antibody
ABD9510	Lifescience Market	100 ug	EUR 438

EIF3A siRNA
20-abx915160	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF3A siRNA
20-abx915161	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF3A Antibody
45975-100ul	SAB	100ul	EUR 252

EIF3A Antibody
45975-50ul	SAB	50ul	EUR 187

EIF3A Antibody
DF9510	Affbiotech	200ul	EUR 304
Description: EIF3A Antibody detects endogenous levels of total EIF3A.

EIF3A Antibody
1-CSB-PA623903LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

anti-Eif3a
YF-PA25156	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Eif3a

EIF3A Conjugated Antibody
C45975	SAB	100ul	EUR 397

EIF3A Polyclonal Antibody
ES9656-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against EIF3A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

EIF3A Polyclonal Antibody
ES9656-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against EIF3A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

EIF3A Polyclonal Antibody
ABP58469-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human EIF3A protein Applications tips:
Description: A polyclonal antibody for detection of EIF3A from Human, Mouse, Rat. This EIF3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EIF3A protein

EIF3A Polyclonal Antibody
ABP58469-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human EIF3A protein Applications tips:
Description: A polyclonal antibody for detection of EIF3A from Human, Mouse, Rat. This EIF3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EIF3A protein

EIF3A Polyclonal Antibody
ABP58469-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human EIF3A protein Applications tips:
Description: A polyclonal antibody for detection of EIF3A from Human, Mouse, Rat. This EIF3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EIF3A protein

EIF3A Rabbit pAb
A0573-100ul	Abclonal	100 ul	EUR 308

EIF3A Rabbit pAb
A0573-200ul	Abclonal	200 ul	EUR 459

EIF3A Rabbit pAb
A0573-20ul	Abclonal	20 ul	EUR 183

EIF3A Rabbit pAb
A0573-50ul	Abclonal	50 ul	EUR 223

EIF3A Blocking Peptide
DF9510-BP	Affbiotech	1mg	EUR 195

EIF3A cloning plasmid
CSB-CL623903HU-10ug	Cusabio	10ug	EUR 1629
Formulation: 10 μg plasmid + 200μl Glycerol Length: 4149 Sequence: ATGCCGGCCTATTTTCAGAGGCCGGAAAATGCCCTCAAACGCGCCAACGAATTTCTTGAGGTTGGCAAAAAGCAGCCTGCTCTGGATGTTCTTTATGATGTTATGAAAAGTAAAAAACATAGAACATGGCAAAAGATACACGAACCAATTATGTTGAAATACTTGGAACTTTGCG Show more
Description: A cloning plasmid for the EIF3A gene.

Anti-EIF3A antibody
STJ29809	St John's Laboratory	100 µl	EUR 277

Anti-EIF3A antibody
STJ190814	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to EIF3A

Anti-Eif3a (2G4)
YF-MA16469	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Eif3a

Rat EIF3A shRNA Plasmid
20-abx988556	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human EIF3A ELISA Kit
EHE0054	Abclonal	96Tests	EUR 521

Human EIF3A ELISA Kit
ELA-E1885h	Lifescience Market	96 Tests	EUR 824

Goat EIF3A ELISA Kit
EGTE0054	Abclonal	96Tests	EUR 521

Canine EIF3A ELISA Kit
ECE0054	Abclonal	96Tests	EUR 521

Bovine EIF3A ELISA Kit
EBE0054	Abclonal	96Tests	EUR 521

Anserini EIF3A ELISA Kit
EAE0054	Abclonal	96Tests	EUR 521

Mouse Eif3a ELISA KIT
ELI-06046m	Lifescience Market	96 Tests	EUR 865

Human EIF3A ELISA KIT
ELI-06047h	Lifescience Market	96 Tests	EUR 824

EIF3A ELISA KIT|Human
EF006084	Lifescience Market	96 Tests	EUR 689

Porcine EIF3A ELISA Kit
EPE0054	Abclonal	96Tests	EUR 521

Rat EIF3A ELISA Kit
ERE0054	Abclonal	96Tests	EUR 521

Rabbit EIF3A ELISA Kit
ERTE0054	Abclonal	96Tests	EUR 521

Mouse EIF3A ELISA Kit
EME0054	Abclonal	96Tests	EUR 521

Human EIF3A shRNA Plasmid
20-abx955696	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse EIF3A shRNA Plasmid
20-abx970142	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EIF3A Antibody, HRP conjugated
1-CSB-PA623903LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EIF3A Antibody, FITC conjugated
1-CSB-PA623903LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EIF3A Antibody, Biotin conjugated
1-CSB-PA623903LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Guinea Pig EIF3A ELISA Kit
EGE0054	Abclonal	96Tests	EUR 521

Eif3a ORF Vector (Rat) (pORF)
ORF066448	ABM	1.0 ug DNA	EUR 2080

Eif3a ORF Vector (Mouse) (pORF)
ORF043757	ABM	1.0 ug DNA	EUR 1572

EIF3A ORF Vector (Human) (pORF)
ORF012910	ABM	1.0 ug DNA	EUR 354

EIF3A ELISA Kit (Human) (OKEH01347)
OKEH01347	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23 ng/mL

EIF3A ELISA Kit (Mouse) (OKEI00448)
OKEI00448	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL

EIF3A sgRNA CRISPR Lentivector set (Human)
K0667001	ABM	3 x 1.0 ug	EUR 339

Eif3a sgRNA CRISPR Lentivector set (Mouse)
K3834701	ABM	3 x 1.0 ug	EUR 339

Eif3a sgRNA CRISPR Lentivector set (Rat)
K6605701	ABM	3 x 1.0 ug	EUR 339

EIF3A sgRNA CRISPR Lentivector (Human) (Target 1)
K0667002	ABM	1.0 ug DNA	EUR 154

EIF3A sgRNA CRISPR Lentivector (Human) (Target 2)
K0667003	ABM	1.0 ug DNA	EUR 154

EIF3A sgRNA CRISPR Lentivector (Human) (Target 3)
K0667004	ABM	1.0 ug DNA	EUR 154

Eukaryotic Translation Initiation Factor 3A (EIF3A) Antibody
20-abx104335	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody
20-abx005944	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody
20-abx215114	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody
20-abx302524	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody
20-abx225157	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Eif3a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3834702	ABM	1.0 ug DNA	EUR 154

Eif3a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3834703	ABM	1.0 ug DNA	EUR 154

Eif3a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3834704	ABM	1.0 ug DNA	EUR 154

Eif3a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6605702	ABM	1.0 ug DNA	EUR 154

Eif3a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6605703	ABM	1.0 ug DNA	EUR 154

Eif3a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6605704	ABM	1.0 ug DNA	EUR 154

EIF3A Protein Vector (Human) (pPB-C-His)
PV051637	ABM	500 ng	EUR 481

EIF3A Protein Vector (Human) (pPB-N-His)
PV051638	ABM	500 ng	EUR 481

EIF3A Protein Vector (Human) (pPM-C-HA)
PV051639	ABM	500 ng	EUR 481

EIF3A Protein Vector (Human) (pPM-C-His)
PV051640	ABM	500 ng	EUR 481