EIF3A

EIF3A siRNA
20-abx915160
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF3A siRNA
20-abx915161
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF3A siRNA
20-abx901678
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF3A Antibody
ABD9510 100 ug
EUR 438.00

EIF3A Antibody
45975-100ul 100ul
EUR 252.00

EIF3A Antibody
45975-50ul 50ul
EUR 187.00

EIF3A Antibody
1-CSB-PA623903LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

EIF3A Antibody
DF9510 200ul
EUR 304.00
Description: EIF3A Antibody detects endogenous levels of total EIF3A.

anti-Eif3a
YF-PA25156 50 ul
EUR 334.00
Description: Mouse polyclonal to Eif3a

EIF3A Rabbit pAb
A0573-100ul 100 ul
EUR 308.00

EIF3A Rabbit pAb
A0573-200ul 200 ul
EUR 459.00

EIF3A Rabbit pAb
A0573-20ul 20 ul
EUR 183.00

EIF3A Rabbit pAb
A0573-50ul 50 ul
EUR 223.00

EIF3A Blocking Peptide
DF9510-BP 1mg
EUR 195.00

EIF3A Conjugated Antibody
C45975 100ul
EUR 397.00

EIF3A cloning plasmid
CSB-CL623903HU-10ug 10ug
EUR 1629.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4149
  • Sequence: ATGCCGGCCTATTTTCAGAGGCCGGAAAATGCCCTCAAACGCGCCAACGAATTTCTTGAGGTTGGCAAAAAGCAGCCTGCTCTGGATGTTCTTTATGATGTTATGAAAAGTAAAAAACATAGAACATGGCAAAAGATACACGAACCAATTATGTTGAAATACTTGGAACTTTGCG
  • Show more
Description: A cloning plasmid for the EIF3A gene.

EIF3A Polyclonal Antibody
ABP58469-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human EIF3A protein
  • Applications tips:
Description: A polyclonal antibody for detection of EIF3A from Human, Mouse, Rat. This EIF3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EIF3A protein

EIF3A Polyclonal Antibody
ABP58469-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human EIF3A protein
  • Applications tips:
Description: A polyclonal antibody for detection of EIF3A from Human, Mouse, Rat. This EIF3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EIF3A protein

EIF3A Polyclonal Antibody
ABP58469-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human EIF3A protein
  • Applications tips:
Description: A polyclonal antibody for detection of EIF3A from Human, Mouse, Rat. This EIF3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EIF3A protein

EIF3A Polyclonal Antibody
ES9656-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against EIF3A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

EIF3A Polyclonal Antibody
ES9656-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against EIF3A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-EIF3A antibody
STJ29809 100 µl
EUR 277.00

Anti-EIF3A antibody
STJ190814 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to EIF3A

Anti-Eif3a (2G4)
YF-MA16469 100 ug
EUR 363.00
Description: Mouse monoclonal to Eif3a

Human EIF3A shRNA Plasmid
20-abx955696
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF3A shRNA Plasmid
20-abx970142
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EIF3A Antibody, HRP conjugated
1-CSB-PA623903LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EIF3A Antibody, FITC conjugated
1-CSB-PA623903LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EIF3A Antibody, Biotin conjugated
1-CSB-PA623903LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat EIF3A shRNA Plasmid
20-abx988556
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF3A ELISA Kit
EME0054 96Tests
EUR 521.00

Anserini EIF3A ELISA Kit
EAE0054 96Tests
EUR 521.00

Bovine EIF3A ELISA Kit
EBE0054 96Tests
EUR 521.00

Canine EIF3A ELISA Kit
ECE0054 96Tests
EUR 521.00

EIF3A ELISA KIT|Human
EF006084 96 Tests
EUR 689.00

Mouse Eif3a ELISA KIT
ELI-06046m 96 Tests
EUR 865.00

Human EIF3A ELISA KIT
ELI-06047h 96 Tests
EUR 824.00

Goat EIF3A ELISA Kit
EGTE0054 96Tests
EUR 521.00

Human EIF3A ELISA Kit
ELA-E1885h 96 Tests
EUR 824.00

Rat EIF3A ELISA Kit
ERE0054 96Tests
EUR 521.00

Rabbit EIF3A ELISA Kit
ERTE0054 96Tests
EUR 521.00

Porcine EIF3A ELISA Kit
EPE0054 96Tests
EUR 521.00

Human EIF3A ELISA Kit
EHE0054 96Tests
EUR 521.00

Guinea Pig EIF3A ELISA Kit
EGE0054 96Tests
EUR 521.00

Eif3a ORF Vector (Rat) (pORF)
ORF066448 1.0 ug DNA
EUR 2080.00

EIF3A ORF Vector (Human) (pORF)
ORF012910 1.0 ug DNA
EUR 354.00

Eif3a ORF Vector (Mouse) (pORF)
ORF043757 1.0 ug DNA
EUR 1572.00

EIF3A sgRNA CRISPR Lentivector set (Human)
K0667001 3 x 1.0 ug
EUR 339.00

Eif3a sgRNA CRISPR Lentivector set (Mouse)
K3834701 3 x 1.0 ug
EUR 339.00

Eif3a sgRNA CRISPR Lentivector set (Rat)
K6605701 3 x 1.0 ug
EUR 339.00

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody
20-abx215114
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody
20-abx302524
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody
20-abx005944
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3A (EIF3A) Antibody
20-abx104335
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody
20-abx225157
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

EIF3A sgRNA CRISPR Lentivector (Human) (Target 1)
K0667002 1.0 ug DNA
EUR 154.00

EIF3A sgRNA CRISPR Lentivector (Human) (Target 2)
K0667003 1.0 ug DNA
EUR 154.00

EIF3A sgRNA CRISPR Lentivector (Human) (Target 3)
K0667004 1.0 ug DNA
EUR 154.00

Eif3a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3834702 1.0 ug DNA
EUR 154.00

Eif3a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3834703 1.0 ug DNA
EUR 154.00

Eif3a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3834704 1.0 ug DNA
EUR 154.00

Eif3a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6605702 1.0 ug DNA
EUR 154.00

Eif3a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6605703 1.0 ug DNA
EUR 154.00

Eif3a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6605704 1.0 ug DNA
EUR 154.00

Recombinant Eukaryotic Translation Initiation Factor 3A (EIF3A)
4-RPB885Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P23116
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.3kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Eukaryotic Translation Initiation Factor 3A expressed in: E.coli

EIF3A 3'UTR Luciferase Stable Cell Line
TU006728 1.0 ml
EUR 1394.00

EIF3A Protein Vector (Mouse) (pPB-C-His)
PV175026 500 ng
EUR 2300.00

EIF3A Protein Vector (Mouse) (pPB-N-His)
PV175027 500 ng
EUR 2300.00

EIF3A Protein Vector (Mouse) (pPM-C-HA)
PV175028 500 ng
EUR 2300.00

EIF3A Protein Vector (Mouse) (pPM-C-His)
PV175029 500 ng
EUR 2300.00