EIF4EBP1

EIF4EBP1 Antibody

1-CSB-PA000769
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF4EBP1. Recognizes EIF4EBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

EIF4EBP1 Antibody

1-CSB-PA000770
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF4EBP1. Recognizes EIF4EBP1 from Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

EIF4EBP1 Antibody

CSB-PA007561KA01HU-
EUR 335.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against EIF4EBP1. Recognizes EIF4EBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

EIF4EBP1 Antibody

CSB-PA007561KA01HU-100ul 100ul
EUR 389.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against EIF4EBP1. Recognizes EIF4EBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

EIF4EBP1 Antibody

1-CSB-PA007993
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF4EBP1. Recognizes EIF4EBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

EIF4EBP1 Antibody

1-CSB-PA007994
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF4EBP1. Recognizes EIF4EBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

EIF4EBP1 Antibody

1-CSB-PA007995
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF4EBP1. Recognizes EIF4EBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

EIF4EBP1 Antibody

1-CSB-PA007996
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF4EBP1. Recognizes EIF4EBP1 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

EIF4EBP1 Antibody

1-CSB-PA087889
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EIF4EBP1. Recognizes EIF4EBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

EIF4EBP1 Antibody

1-CSB-PA623815LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF4EBP1. Recognizes EIF4EBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

EIF4EBP1 Antibody

1-CSB-PA588410
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EIF4EBP1. Recognizes EIF4EBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

EIF4EBP1 antibody

38227-100ul 100ul
EUR 252.00

EIF4EBP1 Antibody

35610-100ul 100ul
EUR 252.00

EIF4EBP1 Protein

20-abx260444
  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

EIF4EBP1 Antibody

20-abx330243
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EIF4EBP1 siRNA

20-abx901688
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4EBP1 siRNA

20-abx915203
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4EBP1 siRNA

20-abx915204
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4EBP1 Antibody

DF6380 200ul
EUR 304.00
Description: EIF4EBP1 Antibody detects endogenous levels of total EIF4EBP1.

EIF4EBP1 Antibody

ABD6380 100 ug
EUR 438.00

eIF4EBP1 Antibody

49297-100ul 100ul
EUR 333.00

eIF4EBP1 Antibody

49297-50ul 50ul
EUR 239.00

anti-eIF4EBP1

YF-PA23634 50 ul
EUR 334.00
Description: Mouse polyclonal to eIF4EBP1

EIF4EBP1 (pT36) Antibody

20-abx123363
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

EIF4EBP1 (pT69) Antibody

20-abx123364
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

EIF4EBP1 Conjugated Antibody

C38227 100ul
EUR 397.00

eIF4EBP1 Conjugated Antibody

C49297 100ul
EUR 397.00

EIF4EBP1 Conjugated Antibody

C35610 100ul
EUR 397.00

EIF4EBP1 cloning plasmid

CSB-CL623815HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 357
  • Sequence: atgtccgggggcagcagctgcagccagaccccaagccgggccatccccgccactcgccgggtggtgctcggcgacggcgtgcagctcccgcccggggactacagcacgacccccggcggcacgctcttcagcaccaccccgggaggtaccaggatcatctatgaccggaaattcct
  • Show more
Description: A cloning plasmid for the EIF4EBP1 gene.

EIF4EBP1 (pT36) Antibody

abx031976-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

EIF4EBP1 (pT36) Antibody

abx031976-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

EIF4EBP1 (pS65) Antibody

20-abx000117
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

EIF4EBP1 (pT45) Antibody

20-abx000271
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

EIF4EBP1 (pT36) Antibody

20-abx000392
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

EIF4EBP1 (pT70) Antibody

abx332860-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.

EIF4EBP1 (pT69) Antibody

20-abx330235
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EIF4EBP1 Polyclonal Antibody

E-AB-30370-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Regulates eIF4E activity by preventing its assembly into the eIF4F complex. Mediates the reg
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat EIF4EBP1 for WB,IHC-p,ELISA applications.

EIF4EBP1 Polyclonal Antibody

E-AB-30370-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Regulates eIF4E activity by preventing its assembly into the eIF4F complex. Mediates the reg
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat EIF4EBP1 for WB,IHC-p,ELISA applications.

EIF4EBP1 Polyclonal Antibody

E-AB-30370-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Regulates eIF4E activity by preventing its assembly into the eIF4F complex. Mediates the reg
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat EIF4EBP1 for WB,IHC-p,ELISA applications.

EIF4EBP1 Polyclonal Antibody

E-AB-30371-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Regulates eIF4E activity by preventing its assembly into the eIF4F complex. Mediates the reg
  • Show more
Description: Rabbit antibody against Mouse,Rat,Monkey EIF4EBP1 for WB,IHC-p,ELISA applications.

EIF4EBP1 Polyclonal Antibody

E-AB-30371-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Regulates eIF4E activity by preventing its assembly into the eIF4F complex. Mediates the reg
  • Show more
Description: Rabbit antibody against Mouse,Rat,Monkey EIF4EBP1 for WB,IHC-p,ELISA applications.

EIF4EBP1 Polyclonal Antibody

E-AB-30371-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Regulates eIF4E activity by preventing its assembly into the eIF4F complex. Mediates the reg
  • Show more
Description: Rabbit antibody against Mouse,Rat,Monkey EIF4EBP1 for WB,IHC-p,ELISA applications.

EIF4EBP1 Blocking Peptide

DF6380-BP 1mg
EUR 195.00

EIF4EBP1 Rabbit pAb

A16667-100ul 100 ul
EUR 308.00

EIF4EBP1 Rabbit pAb

A16667-200ul 200 ul
EUR 459.00

EIF4EBP1 Rabbit pAb

A16667-20ul 20 ul
EUR 183.00

EIF4EBP1 Rabbit pAb

A16667-50ul 50 ul
EUR 223.00

eIF4EBP1 Rabbit mAb

A19045-100ul 100 ul
EUR 410.00

eIF4EBP1 Rabbit mAb

A19045-200ul 200 ul
EUR 571.00

eIF4EBP1 Rabbit mAb

A19045-20ul 20 ul
EUR 221.00

eIF4EBP1 Rabbit mAb

A19045-50ul 50 ul
EUR 287.00

EIF4EBP1 Polyclonal Antibody

E-AB-40292-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3.
  • Purified by: Affinity purification
  • Background: Eukaryotic translation initiation factor 4E-binding protein 1(4EBP1),is a member of 4EBPs family,which reg
  • Show more
Description: Rabbit antibody against Human EIF4EBP1 for IHC applications.

EIF4EBP1 Polyclonal Antibody

E-AB-40292-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3.
  • Purified by: Affinity purification
  • Background: Eukaryotic translation initiation factor 4E-binding protein 1(4EBP1),is a member of 4EBPs family,which reg
  • Show more
Description: Rabbit antibody against Human EIF4EBP1 for IHC applications.

EIF4EBP1 Polyclonal Antibody

E-AB-40292-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3.
  • Purified by: Affinity purification
  • Background: Eukaryotic translation initiation factor 4E-binding protein 1(4EBP1),is a member of 4EBPs family,which reg
  • Show more
Description: Rabbit antibody against Human EIF4EBP1 for IHC applications.

Anti-EIF4EBP1 antibody

STJ119096 100 µl
EUR 277.00

Anti-EIF4EBP1 antibody

STJ29842 100 µl
EUR 413.00
Description: This gene encodes one member of a family of translation repressor proteins. The protein directly interacts with eukaryotic translation initiation factor 4E (eIF4E), which is a limiting component of the multisubunit complex that recruits 40S ribosomal subunits to the 5' end of mRNAs. Interaction of this protein with eIF4E inhibits complex assembly and represses translation. This protein is phosphorylated in response to various signals including UV irradiation and insulin signaling, resulting in its dissociation from eIF4E and activation of mRNA translation.

Anti-eIF4EBP1 (1F7)

YF-MA12801 100 ug
EUR 363.00
Description: Mouse monoclonal to eIF4EBP1

Rat EIF4EBP1 shRNA Plasmid

20-abx987302
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal EIF4EBP1 Antibody (Center)

APR07669G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EIF4EBP1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal EIF4EBP1 Antibody (T69)

APR07670G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EIF4EBP1 (T69). This antibody is tested and proven to work in the following applications:

Phospho-EIF4EBP1 (T69) Antibody

1-CSB-PA006340
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-EIF4EBP1 (T69). Recognizes Phospho-EIF4EBP1 (T69) from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

Phospho-EIF4EBP1 (T37) Antibody

1-CSB-PA007989
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-EIF4EBP1 (T37). Recognizes Phospho-EIF4EBP1 (T37) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-EIF4EBP1 (T46) Antibody

1-CSB-PA007990
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-EIF4EBP1 (T46). Recognizes Phospho-EIF4EBP1 (T46) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Phospho-EIF4EBP1 (S65) Antibody

1-CSB-PA007991
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-EIF4EBP1 (S65). Recognizes Phospho-EIF4EBP1 (S65) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-EIF4EBP1 (T70) Antibody

1-CSB-PA007992
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-EIF4EBP1 (T70). Recognizes Phospho-EIF4EBP1 (T70) from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

EIF4EBP1 (Ab-36) Antibody

CSB-PA118316-
EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against EIF4EBP1 (Ab-36). Recognizes EIF4EBP1 (Ab-36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

EIF4EBP1 (Ab-36) Antibody

CSB-PA118316-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against EIF4EBP1 (Ab-36). Recognizes EIF4EBP1 (Ab-36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

Phospho-EIF4EBP1 (Ser64) Antibody

CSB-PA086512-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-EIF4EBP1 (Ser64). Recognizes Phospho-EIF4EBP1 (Ser64) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-EIF4EBP1 (Ser64) Antibody

CSB-PA086512-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-EIF4EBP1 (Ser64). Recognizes Phospho-EIF4EBP1 (Ser64) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-EIF4EBP1 (Thr45) Antibody

CSB-PA024565-
EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-EIF4EBP1 (Thr45). Recognizes Phospho-EIF4EBP1 (Thr45) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100