Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

DLR-ERN1-Hu-96T 96T
EUR 673
  • Should the Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

RDR-ERN1-Hu-48Tests 48 Tests
EUR 544

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

RDR-ERN1-Hu-96Tests 96 Tests
EUR 756

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

RD-ERN1-Hu-48Tests 48 Tests
EUR 521

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

RD-ERN1-Hu-96Tests 96 Tests
EUR 723

ERN1 antibody

10R-2179 100 ul
EUR 403
Description: Mouse monoclonal ERN1 antibody

ERN1 Antibody

45272-100ul 100ul
EUR 252

ERN1 Antibody

45272-50ul 50ul
EUR 187

ERN1 Antibody

BF0223 200ul
EUR 376
Description: ERN1 antibody detects endogenous levels of total ERN1.

ERN1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERN1. Recognizes ERN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ERN1 Antibody

ABD8322 100 ug
EUR 438

ERN1 Conjugated Antibody

C45272 100ul
EUR 397

ERN1 Blocking Peptide

BF0223-BP 1mg
EUR 195

ERN1 cloning plasmid

CSB-CL007795HU-10ug 10ug
EUR 931
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2934
  • Sequence: atgccggcccggcggctgctgctgctgctgacgctgctgctgcccggcctcgggatttttggaagtaccagcacagtgacgcttcctgaaaccttgttgtttgtgtcaacgctggatggaagtttgcatgctgtcagcaagaggacaggctcaatcaaatggactttaaaagaag
  • Show more
Description: A cloning plasmid for the ERN1 gene.

ERN1 Rabbit pAb

A17940-100ul 100 ul
EUR 308

ERN1 Rabbit pAb

A17940-200ul 200 ul
EUR 459

ERN1 Rabbit pAb

A17940-20ul 20 ul
EUR 183

ERN1 Rabbit pAb

A17940-50ul 50 ul
EUR 223

anti-ERN1 (9F2)

LF-MA30373 100 ul
EUR 486
Description: Mouse Monoclonal to ERN1

Anti-ERN1 antibody

STJ119924 100 µl
EUR 277
Description: The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals.

Anti-ERN1 Antibody

STJ501494 100 µg
EUR 476

Anti-ERN1 Antibody

STJ501495 100 µg
EUR 476

Anti-IRE1/ERN1 Antibody

A00683-1 100ug/vial
EUR 294

Human ERN1 ELISA Kit

EHE0067 96Tests
EUR 521

Human ERN1 ELISA Kit

ELA-E7165h 96 Tests
EUR 824


EGTE0067 96Tests
EUR 521

Bovine ERN1 ELISA Kit

EBE0067 96Tests
EUR 521

Canine ERN1 ELISA Kit

ECE0067 96Tests
EUR 521

Chicken ERN1 ELISA Kit

ECKE0067 96Tests
EUR 521

Anserini ERN1 ELISA Kit

EAE0067 96Tests
EUR 521


ELI-07578h 96 Tests
EUR 824

Mouse Ern1 ELISA KIT

ELI-07579m 96 Tests
EUR 865


EF006417 96 Tests
EUR 689

Mouse ERN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ERN1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERN1. Recognizes ERN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ERN1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERN1. Recognizes ERN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ERN1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERN1. Recognizes ERN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human ERN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ERN1 ELISA Kit

EME0067 96Tests
EUR 521


ERE0067 96Tests
EUR 521

Sheep ERN1 ELISA Kit

ESE0067 96Tests
EUR 521

Rabbit ERN1 ELISA Kit

ERTE0067 96Tests
EUR 521

Monkey ERN1 ELISA Kit

EMKE0067 96Tests
EUR 521

Porcine ERN1 ELISA Kit

EPE0067 96Tests
EUR 521

pCR4-TOPO-ERN1 Plasmid

PVTB00832-1 2 ug
EUR 356

p3*Flag-ERN1 Plasmid

PVTB00832-2a 2 ug
EUR 356

Anti-ERN1 Antibody (Biotin)

STJ501496 100 µg
EUR 586

Anti-ERN1 Antibody (FITC)

STJ501497 100 µg
EUR 586

Anti-ERN1 Antibody (Biotin)

STJ501498 100 µg
EUR 586

Anti-ERN1 Antibody (FITC)

STJ501499 100 µg
EUR 586

Anti-ERN1 / IRE1a antibody

STJ71581 100 µg
EUR 359

Phospho-ERN1-Ser551 Rabbit pAb

AP0911-100ul 100 ul
EUR 384

Phospho-ERN1-Ser551 Rabbit pAb

AP0911-200ul 200 ul
EUR 554

Phospho-ERN1-Ser551 Rabbit pAb

AP0911-20ul 20 ul
EUR 183

Phospho-ERN1-Ser551 Rabbit pAb

AP0911-50ul 50 ul
EUR 265

Guinea Pig ERN1 ELISA Kit

EGE0067 96Tests
EUR 521

Monoclonal ERN1 Antibody, Clone: 9F2

AMM02755G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human ERN1. The antibodies are raised in Mouse and are from clone 9F2. This antibody is applicable in WB and IHC, E

Ern1 ORF Vector (Rat) (pORF)

ORF066641 1.0 ug DNA
EUR 506

ERN1 ORF Vector (Human) (pORF)

ORF018964 1.0 ug DNA
EUR 405

Ern1 ORF Vector (Mouse) (pORF)

ORF044070 1.0 ug DNA
EUR 506

pECMV-Ern1-m-FLAG Plasmid

PVT15683 2 ug
EUR 325

Anti-Phospho-ERN1-Ser551 antibody

STJ11101046 100 µl
EUR 393
Description: The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals.

ERN1 ELISA Kit (Human) (OKCD08139)

OKCD08139 96 Wells
EUR 975
Description: Description of target: This gene encodes the transmembrane protein kinase inositol-requiring enzyme 1. The encoded protein contains two functional catalytic domains, a serine/threonine-protein kinase domain and an endoribonuclease domain. This protein functions as a sensor of unfolded proteins in the endoplasmic reticulum (ER) and triggers an intracellular signaling pathway termed the unfolded protein response (UPR). The UPR is an ER stress response that is conserved from yeast to mammals and activates genes involved in degrading misfolded proteins, regulating protein synthesis and activating molecular chaperones. This protein specifically mediates the splicing and activation of the stress response transcription factor X-box binding protein 1.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

ERN1 ELISA Kit (Mouse) (OKEI00445)

OKEI00445 96 Wells
EUR 767
Description: Description of target: Senses unfolded proteins in the lumen of the endoplasmic reticulum via its N-terminal domain which leads to enzyme auto-activation. The active endoribonuclease domain splices XBP1 mRNA to generate a new C-terminus, converting it into a potent unfolded-protein response transcriptional activator and triggering growth arrest and apoptosis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23.438 pg/mL

ERN1 ELISA Kit (Rat) (OKEI00764)

OKEI00764 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL

ERN1 ELISA Kit (Rat) (OKWB00356)

OKWB00356 96 Wells
EUR 572
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 9.4 pg/mL

Polyclonal ERN1 / IRE1 Antibody (C-Terminus)

APR02986G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ERN1 / IRE1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse Ern1 Antibody (C-term)

APR03932G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Ern1 (C-term). This antibody is tested and proven to work in the following applications: