ERN1

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit
DLR-ERN1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit
RD-ERN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit
RD-ERN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit
RDR-ERN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit
RDR-ERN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

ERN1 Antibody
BF0223	Affbiotech	200ul	EUR 376
Description: ERN1 antibody detects endogenous levels of total ERN1.

ERN1 siRNA
20-abx915656	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ERN1 siRNA
20-abx915657	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ERN1 Antibody
ABD8322	Lifescience Market	100 ug	EUR 438

ERN1 Antibody
45272-100ul	SAB	100ul	EUR 252

ERN1 Antibody
45272-50ul	SAB	50ul	EUR 187

ERN1 antibody
10R-2179	Fitzgerald	100 ul	EUR 403
Description: Mouse monoclonal ERN1 antibody

ERN1 Antibody
1-CSB-PA007795LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERN1. Recognizes ERN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ERN1 Conjugated Antibody
C45272	SAB	100ul	EUR 397

ERN1 Blocking Peptide
BF0223-BP	Affbiotech	1mg	EUR 195

ERN1 cloning plasmid
CSB-CL007795HU-10ug	Cusabio	10ug	EUR 931
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2934 Sequence: atgccggcccggcggctgctgctgctgctgacgctgctgctgcccggcctcgggatttttggaagtaccagcacagtgacgcttcctgaaaccttgttgtttgtgtcaacgctggatggaagtttgcatgctgtcagcaagaggacaggctcaatcaaatggactttaaaagaag Show more
Description: A cloning plasmid for the ERN1 gene.

ERN1 Rabbit pAb
A17940-100ul	Abclonal	100 ul	EUR 308

ERN1 Rabbit pAb
A17940-200ul	Abclonal	200 ul	EUR 459

ERN1 Rabbit pAb
A17940-20ul	Abclonal	20 ul	EUR 183

ERN1 Rabbit pAb
A17940-50ul	Abclonal	50 ul	EUR 223

anti-ERN1 (9F2)
LF-MA30373	Abfrontier	100 ul	EUR 486
Description: Mouse Monoclonal to ERN1

Anti-ERN1 Antibody
STJ501494	St John's Laboratory	100 µg	EUR 476

Anti-ERN1 Antibody
STJ501495	St John's Laboratory	100 µg	EUR 476

Anti-ERN1 antibody
STJ119924	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals.

Mouse ERN1 shRNA Plasmid
20-abx978990	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ERN1 ELISA Kit
EHE0067	Abclonal	96Tests	EUR 521

Human ERN1 ELISA Kit
ELA-E7165h	Lifescience Market	96 Tests	EUR 824

Goat ERN1 ELISA Kit
EGTE0067	Abclonal	96Tests	EUR 521

Canine ERN1 ELISA Kit
ECE0067	Abclonal	96Tests	EUR 521

Chicken ERN1 ELISA Kit
ECKE0067	Abclonal	96Tests	EUR 521

Bovine ERN1 ELISA Kit
EBE0067	Abclonal	96Tests	EUR 521

Anserini ERN1 ELISA Kit
EAE0067	Abclonal	96Tests	EUR 521

Human ERN1 ELISA KIT
ELI-07578h	Lifescience Market	96 Tests	EUR 824

Mouse Ern1 ELISA KIT
ELI-07579m	Lifescience Market	96 Tests	EUR 865

ERN1 ELISA KIT|Human
EF006417	Lifescience Market	96 Tests	EUR 689

Porcine ERN1 ELISA Kit
EPE0067	Abclonal	96Tests	EUR 521

Rat ERN1 ELISA Kit
ERE0067	Abclonal	96Tests	EUR 521

Rabbit ERN1 ELISA Kit
ERTE0067	Abclonal	96Tests	EUR 521

Sheep ERN1 ELISA Kit
ESE0067	Abclonal	96Tests	EUR 521

Mouse ERN1 ELISA Kit
EME0067	Abclonal	96Tests	EUR 521

Monkey ERN1 ELISA Kit
EMKE0067	Abclonal	96Tests	EUR 521

Human ERN1 shRNA Plasmid
20-abx951453	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-IRE1/ERN1 Antibody
A00683-1	BosterBio	100ug/vial	EUR 294

ERN1 Antibody, HRP conjugated
1-CSB-PA007795LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERN1. Recognizes ERN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ERN1 Antibody, FITC conjugated
1-CSB-PA007795LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERN1. Recognizes ERN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ERN1 Antibody, Biotin conjugated
1-CSB-PA007795LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERN1. Recognizes ERN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

pCR4-TOPO-ERN1 Plasmid
PVTB00832-1	Lifescience Market	2 ug	EUR 356

p3*Flag-ERN1 Plasmid
PVTB00832-2a	Lifescience Market	2 ug	EUR 356

Anti-ERN1 Antibody (Biotin)
STJ501496	St John's Laboratory	100 µg	EUR 586

Anti-ERN1 Antibody (FITC)
STJ501497	St John's Laboratory	100 µg	EUR 586

Anti-ERN1 Antibody (Biotin)
STJ501498	St John's Laboratory	100 µg	EUR 586

Anti-ERN1 Antibody (FITC)
STJ501499	St John's Laboratory	100 µg	EUR 586

Anti-ERN1 / IRE1a antibody
STJ71581	St John's Laboratory	100 µg	EUR 359

Phospho-ERN1-Ser551 Rabbit pAb
AP0911-100ul	Abclonal	100 ul	EUR 384

Phospho-ERN1-Ser551 Rabbit pAb
AP0911-200ul	Abclonal	200 ul	EUR 554

Phospho-ERN1-Ser551 Rabbit pAb
AP0911-20ul	Abclonal	20 ul	EUR 183

Phospho-ERN1-Ser551 Rabbit pAb
AP0911-50ul	Abclonal	50 ul	EUR 265

Monoclonal ERN1 Antibody, Clone: 9F2
AMM02755G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human ERN1. The antibodies are raised in Mouse and are from clone 9F2. This antibody is applicable in WB and IHC, E

Guinea Pig ERN1 ELISA Kit
EGE0067	Abclonal	96Tests	EUR 521

Ern1 ORF Vector (Rat) (pORF)
ORF066641	ABM	1.0 ug DNA	EUR 506

Ern1 ORF Vector (Mouse) (pORF)
ORF044070	ABM	1.0 ug DNA	EUR 506

ERN1 ORF Vector (Human) (pORF)
ORF018964	ABM	1.0 ug DNA	EUR 405

pECMV-Ern1-m-FLAG Plasmid
PVT15683	Lifescience Market	2 ug	EUR 325

Anti-Phospho-ERN1-Ser551 antibody
STJ11101046	St John's Laboratory	100 µl	EUR 393
Description: The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals.

ERN1 ELISA Kit (Human) (OKCD08139)
OKCD08139	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes the transmembrane protein kinase inositol-requiring enzyme 1. The encoded protein contains two functional catalytic domains, a serine/threonine-protein kinase domain and an endoribonuclease domain. This protein functions as a sensor of unfolded proteins in the endoplasmic reticulum (ER) and triggers an intracellular signaling pathway termed the unfolded protein response (UPR). The UPR is an ER stress response that is conserved from yeast to mammals and activates genes involved in degrading misfolded proteins, regulating protein synthesis and activating molecular chaperones. This protein specifically mediates the splicing and activation of the stress response transcription factor X-box binding protein 1.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

ERN1 ELISA Kit (Mouse) (OKEI00445)
OKEI00445	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Senses unfolded proteins in the lumen of the endoplasmic reticulum via its N-terminal domain which leads to enzyme auto-activation. The active endoribonuclease domain splices XBP1 mRNA to generate a new C-terminus, converting it into a potent unfolded-protein response transcriptional activator and triggering growth arrest and apoptosis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23.438 pg/mL

ERN1 ELISA Kit (Rat) (OKEI00764)
OKEI00764	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL

ERN1 ELISA Kit (Rat) (OKWB00356)
OKWB00356	Aviva Systems Biology	96 Wells	EUR 572
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 9.4 pg/mL

Polyclonal ERN1 / IRE1 Antibody (C-Terminus)
APR02986G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ERN1 / IRE1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-ERN1 / IRE1a Antibody
APG00107G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ERN1 / IRE1a . This antibody is tested and proven to work in the following applications: