ERN1

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

DL-ERN1-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1)

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

DL-ERN1-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1)

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

DLR-ERN1-Hu-48T 48T
EUR 517.00
  • Should the Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

DLR-ERN1-Hu-96T 96T
EUR 673.00
  • Should the Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

RD-ERN1-Hu-48Tests 48 Tests
EUR 521.00

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

RD-ERN1-Hu-96Tests 96 Tests
EUR 723.00

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

RDR-ERN1-Hu-48Tests 48 Tests
EUR 544.00

Human Endoplasmic Reticulum To Nucleus Signalling 1 (ERN1) ELISA Kit

RDR-ERN1-Hu-96Tests 96 Tests
EUR 756.00

ERN1 siRNA

20-abx915656
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ERN1 siRNA

20-abx915657
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ERN1 Antibody

ABD8322 100 ug
EUR 438.00

ERN1 antibody

10R-2179 100 ul
EUR 403.00
Description: Mouse monoclonal ERN1 antibody

ERN1 Antibody

45272-100ul 100ul
EUR 252.00

ERN1 Antibody

45272-50ul 50ul
EUR 187.00

ERN1 Antibody

1-CSB-PA007795LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERN1. Recognizes ERN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ERN1 Antibody

BF0223 200ul
EUR 376.00
Description: ERN1 antibody detects endogenous levels of total ERN1.

ERN1 Rabbit pAb

A17940-100ul 100 ul
EUR 308.00

ERN1 Rabbit pAb

A17940-200ul 200 ul
EUR 459.00

ERN1 Rabbit pAb

A17940-20ul 20 ul
EUR 183.00

ERN1 Rabbit pAb

A17940-50ul 50 ul
EUR 223.00

ERN1 Conjugated Antibody

C45272 100ul
EUR 397.00

ERN1 Blocking Peptide

BF0223-BP 1mg
EUR 195.00

ERN1 cloning plasmid

CSB-CL007795HU-10ug 10ug
EUR 931.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2934
  • Sequence: atgccggcccggcggctgctgctgctgctgacgctgctgctgcccggcctcgggatttttggaagtaccagcacagtgacgcttcctgaaaccttgttgtttgtgtcaacgctggatggaagtttgcatgctgtcagcaagaggacaggctcaatcaaatggactttaaaagaag
  • Show more
Description: A cloning plasmid for the ERN1 gene.

anti-ERN1 (9F2)

LF-MA30373 100 ul
EUR 486.00
Description: Mouse Monoclonal to ERN1

Anti-ERN1 antibody

STJ119924 100 µl
EUR 277.00
Description: The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals.

Anti-ERN1 Antibody

STJ501494 100 µg
EUR 476.00

Anti-ERN1 Antibody

STJ501495 100 µg
EUR 476.00

Human ERN1 shRNA Plasmid

20-abx951453
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ERN1 shRNA Plasmid

20-abx978990
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-IRE1/ERN1 Antibody

A00683-1 100ug/vial
EUR 294.00

ERN1 Antibody, HRP conjugated

1-CSB-PA007795LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERN1. Recognizes ERN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ERN1 Antibody, FITC conjugated

1-CSB-PA007795LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERN1. Recognizes ERN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ERN1 Antibody, Biotin conjugated

1-CSB-PA007795LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERN1. Recognizes ERN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse ERN1 ELISA Kit

EME0067 96Tests
EUR 521.00

Monkey ERN1 ELISA Kit

EMKE0067 96Tests
EUR 521.00

Human ERN1 ELISA KIT

ELI-07578h 96 Tests
EUR 824.00

Mouse Ern1 ELISA KIT

ELI-07579m 96 Tests
EUR 865.00

Anserini ERN1 ELISA Kit

EAE0067 96Tests
EUR 521.00

Bovine ERN1 ELISA Kit

EBE0067 96Tests
EUR 521.00

Canine ERN1 ELISA Kit

ECE0067 96Tests
EUR 521.00

Chicken ERN1 ELISA Kit

ECKE0067 96Tests
EUR 521.00

ERN1 ELISA KIT|Human

EF006417 96 Tests
EUR 689.00

Goat ERN1 ELISA Kit

EGTE0067 96Tests
EUR 521.00

Human ERN1 ELISA Kit

ELA-E7165h 96 Tests
EUR 824.00

Rat ERN1 ELISA Kit

ERE0067 96Tests
EUR 521.00

Rabbit ERN1 ELISA Kit

ERTE0067 96Tests
EUR 521.00

Porcine ERN1 ELISA Kit

EPE0067 96Tests
EUR 521.00

Human ERN1 ELISA Kit

EHE0067 96Tests
EUR 521.00

Sheep ERN1 ELISA Kit

ESE0067 96Tests
EUR 521.00

Anti-ERN1 / IRE1a antibody

STJ71581 100 µg
EUR 359.00

Anti-ERN1 Antibody (Biotin)

STJ501496 100 µg
EUR 586.00

Anti-ERN1 Antibody (FITC)

STJ501497 100 µg
EUR 586.00

Anti-ERN1 Antibody (Biotin)

STJ501498 100 µg
EUR 586.00

Anti-ERN1 Antibody (FITC)

STJ501499 100 µg
EUR 586.00

pCR4-TOPO-ERN1 Plasmid

PVTB00832-1 2 ug
EUR 356.00

p3*Flag-ERN1 Plasmid

PVTB00832-2a 2 ug
EUR 356.00

Phospho-ERN1-Ser551 Rabbit pAb

AP0911-100ul 100 ul
EUR 384.00

Phospho-ERN1-Ser551 Rabbit pAb

AP0911-200ul 200 ul
EUR 554.00

Phospho-ERN1-Ser551 Rabbit pAb

AP0911-20ul 20 ul
EUR 183.00

Phospho-ERN1-Ser551 Rabbit pAb

AP0911-50ul 50 ul
EUR 265.00

Monoclonal ERN1 Antibody, Clone: 9F2

AMM02755G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human ERN1. The antibodies are raised in Mouse and are from clone 9F2. This antibody is applicable in WB and IHC, E

Guinea Pig ERN1 ELISA Kit

EGE0067 96Tests
EUR 521.00

ERN1 ORF Vector (Human) (pORF)

ORF018964 1.0 ug DNA
EUR 405.00

Ern1 ORF Vector (Rat) (pORF)

ORF066641 1.0 ug DNA
EUR 506.00

Ern1 ORF Vector (Mouse) (pORF)

ORF044070 1.0 ug DNA
EUR 506.00

Anti-Phospho-ERN1-Ser551 antibody

STJ11101046 100 µl
EUR 393.00
Description: The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals.

pECMV-Ern1-m-FLAG Plasmid

PVT15683 2 ug
EUR 325.00

Polyclonal ERN1 / IRE1 Antibody (C-Terminus)

APR02986G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ERN1 / IRE1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse Ern1 Antibody (C-term)

APR03932G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Ern1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-ERN1 / IRE1a Antibody

APG00107G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ERN1 / IRE1a . This antibody is tested and proven to work in the following applications: