FXN antibody

70R-17372 50 ul
EUR 435
Description: Rabbit polyclonal FXN antibody

FXN Antibody

32413-100ul 100ul
EUR 252

FXN antibody

10R-6953 100 ul
EUR 691
Description: Mouse monoclonal FXN antibody

FXN antibody

10R-6954 100 ul
EUR 691
Description: Mouse monoclonal FXN antibody

FXN antibody

10R-6956 100 ul
EUR 691
Description: Mouse monoclonal FXN antibody

FXN antibody

10R-6958 100 ul
EUR 726
Description: Mouse monoclonal FXN antibody

FXN Antibody

DF6590 200ul
EUR 304
Description: FXN Antibody detects endogenous levels of total FXN.

Fxn antibody

70R-8779 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Fxn antibody

FXN Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FXN. Recognizes FXN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Fxn Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fxn. Recognizes Fxn from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FXN Antibody

ABD6590 100 ug
EUR 438

Fxn Blocking Peptide

33R-9164 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fxn antibody, catalog no. 70R-8779

FXN Blocking Peptide

DF6590-BP 1mg
EUR 195

Frataxin (FXN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Frataxin (FXN) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Frataxin (FXN) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Frataxin (FXN) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx031313-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx031313-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx032827-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx032827-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx032828-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx032828-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

FXN Conjugated Antibody

C32413 100ul
EUR 397

Frataxin (FXN) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx233255-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

FXN cloning plasmid

CSB-CL613687HU-10ug 10ug
EUR 287
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 633
  • Sequence: atgtggactctcgggcgccgcgcagtagccggcctcctggcgtcacccagcccggcccaggcccagaccctcacccgggtcccgcggccggcagagttggccccactctgcggccgccgtggcctgcgcaccgacatcgatgcgacctgcacgccccgccgcgcaagttcgaacca
  • Show more
Description: A cloning plasmid for the FXN gene.

Fxn Polyclonal Antibody

A59162 100 µg
EUR 570.55
Description: fast delivery possible

FXN Rabbit pAb

A16853-100ul 100 ul
EUR 308

FXN Rabbit pAb

A16853-200ul 200 ul
EUR 459

FXN Rabbit pAb

A16853-20ul 20 ul
EUR 183

FXN Rabbit pAb

A16853-50ul 50 ul
EUR 223

Frataxin (FXN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

anti- FXN antibody

FNab03255 100µg
EUR 585
  • Immunogen: frataxin
  • Uniprot ID: Q16595
  • Gene ID: 2395
  • Research Area: Cancer, Neuroscience, Metabolism, Signal Transduction
Description: Antibody raised against FXN

Anti-FXN antibody

PAab03255 100 ug
EUR 412

Recombinant Frataxin (FXN)

  • EUR 449.44
  • EUR 223.00
  • EUR 1410.40
  • EUR 536.80
  • EUR 973.60
  • EUR 364.00
  • EUR 3376.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16595
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.8kDa
  • Isoelectric Point: 6.8
Description: Recombinant Human Frataxin expressed in: E.coli

Recombinant Frataxin (FXN)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35943
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.4kDa
  • Isoelectric Point: 6.4
Description: Recombinant Mouse Frataxin expressed in: E.coli

Anti-FXN antibody

STJ113368 100 µl
EUR 277
Description: This nuclear gene encodes a mitochondrial protein which belongs to the FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA from 8-33 repeats to >90 repeats results in Friedreich ataxia. Alternative splicing results in multiple transcript variants.

Anti-FXN antibody

STJ119112 100 µl
EUR 413

Anti-FXN antibody

STJ119221 100 µl
EUR 277
Description: This nuclear gene encodes a mitochondrial protein which belongs to the FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA from 8-33 repeats to >90 repeats results in Friedreich ataxia. Alternative splicing results in multiple transcript variants.

Anti-FXN antibody

STJ23722 100 µl
EUR 277
Description: This nuclear gene encodes a mitochondrial protein which belongs to the FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA from 8-33 repeats to >90 repeats results in Friedreich ataxia. Alternative splicing results in multiple transcript variants.

FXN / Frataxin Polyclonal Antibody

27571-100ul 100ul
EUR 252

FXN / Frataxin Polyclonal Antibody

27571-50ul 50ul
EUR 187

FXN / Frataxin Rabbit pAb

A11785-100ul 100 ul
EUR 308

FXN / Frataxin Rabbit pAb

A11785-200ul 200 ul
EUR 459

FXN / Frataxin Rabbit pAb

A11785-20ul 20 ul
EUR 183

FXN / Frataxin Rabbit pAb

A11785-50ul 50 ul
EUR 223

Mouse Frataxin, mitochondrial (Fxn)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Frataxin, mitochondrial(Fxn) expressed in E.coli

Mouse Frataxin, mitochondrial (Fxn)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Frataxin,mitochondrial(Fxn) expressed in E.coli

Rat Frataxin, mitochondrial (Fxn)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 22.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Frataxin, mitochondrial(Fxn) expressed in E.coli

Rat Frataxin, mitochondrial (Fxn)

  • EUR 621.00
  • EUR 381.00
  • EUR 1943.00
  • EUR 882.00
  • EUR 1335.00
  • EUR 451.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 18.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Frataxin, mitochondrial(Fxn) expressed in E.coli

Human Frataxin, mitochondrial (FXN)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 43.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Frataxin, mitochondrial(FXN) expressed in E.coli

Human Frataxin, mitochondrial (FxN)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 28.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Frataxin, mitochondrial(FxN) expressed in E.coli

Mouse Frataxin, mitochondrial (Fxn)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 16.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Frataxin, mitochondrial(Fxn) expressed in Yeast

Human Frataxin (FXN) Protein

  • EUR 634.00
  • EUR 272.00
  • EUR 1901.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Frataxin (FXN) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.


EF009718 96 Tests
EUR 689

Fxn Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fxn. Recognizes Fxn from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Fxn Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fxn. Recognizes Fxn from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Fxn Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fxn. Recognizes Fxn from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Frataxin (FXN) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse FXN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FXN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FXN / Frataxin Rabbit pAb

A1745-100ul 100 ul
EUR 308