GALNT14

GALNT14 Antibody
40030-100ul	SAB	100ul	EUR 390

GALNT14 Antibody
1-CSB-PA836212LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT14. Recognizes GALNT14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GALNT14 Antibody
DF13030	Affbiotech	200ul	EUR 304
Description: GALNT14 Antibody detects endogenous levels of GALNT14.

GALNT14 antibody
70R-7437	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GALNT14 antibody

GALNT14 Antibody
1-CSB-PA009208GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GALNT14. Recognizes GALNT14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GALNT14 siRNA
20-abx917526	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GALNT14 siRNA
20-abx917527	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GALNT14
YF-PA20816	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to GALNT14

anti-GALNT14
YF-PA20817	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to GALNT14

anti-GALNT14
YF-PA20818	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to GALNT14

GALNT14 Blocking Peptide
33R-4908	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALNT14 antibody, catalog no. 70R-7437

GALNT14 Blocking Peptide
DF13030-BP	Affbiotech	1mg	EUR 195

GALNT14 cloning plasmid
CSB-CL836212HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1659 Sequence: atgcggcgcctgactcgtcggctggttctgccagtcttcggggtgctctggatcacggtgctgctgttcttctgggtaaccaagaggaagttggaggtgccgacgggacctgaagtgcagacccctaagccttcggacgctgactgggacgacctgtgggaccagtttgatgagc Show more
Description: A cloning plasmid for the GALNT14 gene.

GALNT14 Polyclonal Antibody
A51073	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

anti- GALNT14 antibody
FNab03323	FN Test	100µg	EUR 548.75
Immunogen: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14(GalNAc-T14) Uniprot ID: Q96FL9 Gene ID: 79623 Research Area: Metabolism
Description: Antibody raised against GALNT14

Anti-GALNT14 antibody
PAab03323	Lifescience Market	100 ug	EUR 386

pCMV-SPORT6-GALNT14
PVT14075	Lifescience Market	2 ug	EUR 391

Anti-GALNT14 (2A8)
YF-MA19332	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GALNT14

GALNT14 Antibody, HRP conjugated
1-CSB-PA836212LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT14. Recognizes GALNT14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GALNT14 Antibody, FITC conjugated
1-CSB-PA836212LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT14. Recognizes GALNT14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GALNT14 Antibody, Biotin conjugated
1-CSB-PA836212LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT14. Recognizes GALNT14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Galnt14 ELISA KIT
ELI-12702m	Lifescience Market	96 Tests	EUR 865

GALNT14 ELISA KIT|Human
EF009762	Lifescience Market	96 Tests	EUR 689

Human GALNT14 ELISA KIT
ELI-43478h	Lifescience Market	96 Tests	EUR 824

Mouse GALNT14 shRNA Plasmid
20-abx977457	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GALNT14 shRNA Plasmid
20-abx962431	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GALNT14 Recombinant Protein (Human)
RP012874	ABM	100 ug	Ask for price

GALNT14 Recombinant Protein (Rat)
RP202166	ABM	100 ug	Ask for price

GALNT14 Recombinant Protein (Mouse)
RP135827	ABM	100 ug	Ask for price

Polyclonal GALNT14 Antibody (N-term)
APR10878G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GALNT14 (N-term). This antibody is tested and proven to work in the following applications:

GALNT14 Polyclonal Antibody, HRP Conjugated
A51074	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

GALNT14 Polyclonal Antibody, FITC Conjugated
A51075	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

GALNT14 Polyclonal Antibody, Biotin Conjugated
A51076	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Galnt14 ORF Vector (Rat) (pORF)
ORF067390	ABM	1.0 ug DNA	EUR 506

GALNT14 ORF Vector (Human) (pORF)
ORF004292	ABM	1.0 ug DNA	EUR 95

Galnt14 ORF Vector (Mouse) (pORF)
ORF045277	ABM	1.0 ug DNA	EUR 506

Human Polypeptide N-acetylgalactosaminyltransferase 14 (GALNT14)
1-CSB-EP836212HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 80.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Polypeptide N-acetylgalactosaminyltransferase 14(GALNT14) expressed in E.coli

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody
20-abx003790	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody
20-abx116518	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody
abx037987-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody
abx030456-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody
abx030456-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody
20-abx318819	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody
abx233323-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Galnt14 sgRNA CRISPR Lentivector set (Rat)
K6518101	ABM	3 x 1.0 ug	EUR 339

Galnt14 sgRNA CRISPR Lentivector set (Mouse)
K3685101	ABM	3 x 1.0 ug	EUR 339

GALNT14 sgRNA CRISPR Lentivector set (Human)
K0836401	ABM	3 x 1.0 ug	EUR 339

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody (HRP)
20-abx309130	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody (FITC)
20-abx309131	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody (Biotin)
20-abx309132	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Galnt14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6518102	ABM	1.0 ug DNA	EUR 154

Galnt14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6518103	ABM	1.0 ug DNA	EUR 154

Galnt14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6518104	ABM	1.0 ug DNA	EUR 154

Galnt14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3685102	ABM	1.0 ug DNA	EUR 154

Galnt14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3685103	ABM	1.0 ug DNA	EUR 154

Galnt14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3685104	ABM	1.0 ug DNA	EUR 154

GALNT14 sgRNA CRISPR Lentivector (Human) (Target 1)
K0836402	ABM	1.0 ug DNA	EUR 154

GALNT14 sgRNA CRISPR Lentivector (Human) (Target 2)
K0836403	ABM	1.0 ug DNA	EUR 154

GALNT14 sgRNA CRISPR Lentivector (Human) (Target 3)
K0836404	ABM	1.0 ug DNA	EUR 154

GALNT14 Protein Vector (Rat) (pPB-C-His)
PV269558	ABM	500 ng	EUR 603

GALNT14 Protein Vector (Rat) (pPB-N-His)
PV269559	ABM	500 ng	EUR 603

GALNT14 Protein Vector (Rat) (pPM-C-HA)
PV269560	ABM	500 ng	EUR 603

GALNT14 Protein Vector (Rat) (pPM-C-His)
PV269561	ABM	500 ng	EUR 603

GALNT14 Protein Vector (Mouse) (pPB-C-His)
PV181106	ABM	500 ng	EUR 603

GALNT14 Protein Vector (Mouse) (pPB-N-His)
PV181107	ABM	500 ng	EUR 603

GALNT14 Protein Vector (Mouse) (pPM-C-HA)
PV181108	ABM	500 ng	EUR 603

GALNT14 Protein Vector (Mouse) (pPM-C-His)
PV181109	ABM	500 ng	EUR 603

GALNT14 Protein Vector (Human) (pPB-C-His)
PV017165	ABM	500 ng	EUR 329

GALNT14 Protein Vector (Human) (pPB-N-His)
PV017166	ABM	500 ng	EUR 329

GALNT14 Protein Vector (Human) (pPM-C-HA)
PV017167	ABM	500 ng	EUR 329