GALNT14

GALNT14 siRNA

20-abx917527
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GALNT14 antibody

70R-7437 50 ug
EUR 467.00
Description: Rabbit polyclonal GALNT14 antibody

GALNT14 antibody

70R-17413 50 ul
EUR 435.00
Description: Rabbit polyclonal GALNT14 antibody

GALNT14 Antibody

1-CSB-PA009208GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GALNT14. Recognizes GALNT14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GALNT14 Antibody

1-CSB-PA836212LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT14. Recognizes GALNT14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GALNT14 Antibody

DF13030 200ul
EUR 304.00
Description: GALNT14 Antibody detects endogenous levels of GALNT14.

GALNT14 Antibody

40030-100ul 100ul
EUR 390.00

anti-GALNT14

YF-PA20816 50 ul
EUR 363.00
Description: Mouse polyclonal to GALNT14

anti-GALNT14

YF-PA20817 50 ug
EUR 363.00
Description: Mouse polyclonal to GALNT14

anti-GALNT14

YF-PA20818 100 ug
EUR 403.00
Description: Rabbit polyclonal to GALNT14

GALNT14 Polyclonal Antibody

A51073 100 µg
EUR 570.55
Description: Ask the seller for details

GALNT14 Blocking Peptide

DF13030-BP 1mg
EUR 195.00

GALNT14 Blocking Peptide

33R-4908 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALNT14 antibody, catalog no. 70R-7437

GALNT14 cloning plasmid

CSB-CL836212HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1659
  • Sequence: atgcggcgcctgactcgtcggctggttctgccagtcttcggggtgctctggatcacggtgctgctgttcttctgggtaaccaagaggaagttggaggtgccgacgggacctgaagtgcagacccctaagccttcggacgctgactgggacgacctgtgggaccagtttgatgagc
  • Show more
Description: A cloning plasmid for the GALNT14 gene.

anti- GALNT14 antibody

FNab03323 100µg
EUR 548.75
  • Immunogen: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14(GalNAc-T14)
  • Uniprot ID: Q96FL9
  • Gene ID: 79623
  • Research Area: Metabolism
Description: Antibody raised against GALNT14

Anti-GALNT14 antibody

PAab03323 100 ug
EUR 386.00

pCMV-SPORT6-GALNT14

PVT14075 2 ug
EUR 391.00

Anti-GALNT14 (2A8)

YF-MA19332 100 ug
EUR 363.00
Description: Mouse monoclonal to GALNT14

Human GALNT14 shRNA Plasmid

20-abx962431
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GALNT14 shRNA Plasmid

20-abx977457
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GALNT14 Antibody, HRP conjugated

1-CSB-PA836212LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT14. Recognizes GALNT14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GALNT14 Antibody, FITC conjugated

1-CSB-PA836212LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT14. Recognizes GALNT14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GALNT14 Antibody, Biotin conjugated

1-CSB-PA836212LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT14. Recognizes GALNT14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GALNT14 ELISA KIT

ELI-43478h 96 Tests
EUR 824.00

Mouse Galnt14 ELISA KIT

ELI-12702m 96 Tests
EUR 865.00

GALNT14 ELISA KIT|Human

EF009762 96 Tests
EUR 689.00

GALNT14 Recombinant Protein (Mouse)

RP135827 100 ug Ask for price

GALNT14 Recombinant Protein (Rat)

RP202166 100 ug Ask for price

GALNT14 Recombinant Protein (Human)

RP012874 100 ug Ask for price

GALNT14 Polyclonal Antibody, HRP Conjugated

A51074 100 µg
EUR 570.55
Description: The best epigenetics products

GALNT14 Polyclonal Antibody, FITC Conjugated

A51075 100 µg
EUR 570.55
Description: kits suitable for this type of research

GALNT14 Polyclonal Antibody, Biotin Conjugated

A51076 100 µg
EUR 570.55
Description: fast delivery possible

Polyclonal GALNT14 Antibody (N-term)

APR10878G 0.1ml
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GALNT14 (N-term). This antibody is tested and proven to work in the following applications:

Galnt14 ORF Vector (Rat) (pORF)

ORF067390 1.0 ug DNA
EUR 506.00

GALNT14 ORF Vector (Human) (pORF)

ORF004292 1.0 ug DNA
EUR 95.00

Galnt14 ORF Vector (Mouse) (pORF)

ORF045277 1.0 ug DNA
EUR 506.00

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody

20-abx318819
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Polypeptide N-acetylgalactosaminyltransferase 14 (GALNT14)

1-CSB-EP836212HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 80.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Polypeptide N-acetylgalactosaminyltransferase 14(GALNT14) expressed in E.coli

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody

abx030456-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody

abx030456-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody

20-abx003790
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody

abx037987-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody

20-abx116518
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody

abx233323-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

GALNT14 sgRNA CRISPR Lentivector set (Human)

K0836401 3 x 1.0 ug
EUR 339.00

Galnt14 sgRNA CRISPR Lentivector set (Mouse)

K3685101 3 x 1.0 ug
EUR 339.00

Galnt14 sgRNA CRISPR Lentivector set (Rat)

K6518101 3 x 1.0 ug
EUR 339.00

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody (HRP)

20-abx309130
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody (FITC)

20-abx309131
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 14 (GALNT14) Antibody (Biotin)

20-abx309132
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GALNT14 sgRNA CRISPR Lentivector (Human) (Target 1)

K0836402 1.0 ug DNA
EUR 154.00

GALNT14 sgRNA CRISPR Lentivector (Human) (Target 2)

K0836403 1.0 ug DNA
EUR 154.00

GALNT14 sgRNA CRISPR Lentivector (Human) (Target 3)

K0836404 1.0 ug DNA
EUR 154.00

Galnt14 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3685102 1.0 ug DNA
EUR 154.00

Galnt14 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3685103 1.0 ug DNA
EUR 154.00

Galnt14 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3685104 1.0 ug DNA
EUR 154.00

Galnt14 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6518102 1.0 ug DNA
EUR 154.00

Galnt14 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6518103 1.0 ug DNA
EUR 154.00

Galnt14 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6518104 1.0 ug DNA
EUR 154.00

GALNT14 Protein Vector (Mouse) (pPB-C-His)

PV181106 500 ng
EUR 603.00

GALNT14 Protein Vector (Mouse) (pPB-N-His)

PV181107 500 ng
EUR 603.00

GALNT14 Protein Vector (Mouse) (pPM-C-HA)

PV181108 500 ng
EUR 603.00

GALNT14 Protein Vector (Mouse) (pPM-C-His)

PV181109 500 ng
EUR 603.00

GALNT14 Protein Vector (Rat) (pPB-C-His)

PV269558 500 ng
EUR 603.00

GALNT14 Protein Vector (Rat) (pPB-N-His)

PV269559 500 ng
EUR 603.00

GALNT14 Protein Vector (Rat) (pPM-C-HA)

PV269560 500 ng
EUR 603.00

GALNT14 Protein Vector (Rat) (pPM-C-His)

PV269561 500 ng
EUR 603.00

GALNT14 Protein Vector (Human) (pPB-C-His)

PV017165 500 ng
EUR 329.00

GALNT14 Protein Vector (Human) (pPB-N-His)

PV017166 500 ng
EUR 329.00

GALNT14 Protein Vector (Human) (pPM-C-HA)

PV017167 500 ng
EUR 329.00