GALNT3

GALNT3 Antibody
1-CSB-PA613501ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GALNT3. Recognizes GALNT3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Galnt3 antibody
70R-8653	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Galnt3 antibody

GALNT3 siRNA
20-abx917538	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GALNT3 siRNA
20-abx917539	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GALNT3
YF-PA11925	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to GALNT3

anti-GALNT3
YF-PA11926	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to GALNT3

anti-GALNT3
YF-PA11927	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to GALNT3

GALNT3 Rabbit pAb
A13985-100ul	Abclonal	100 ul	EUR 308

GALNT3 Rabbit pAb
A13985-200ul	Abclonal	200 ul	EUR 459

GALNT3 Rabbit pAb
A13985-20ul	Abclonal	20 ul	EUR 183

GALNT3 Rabbit pAb
A13985-50ul	Abclonal	50 ul	EUR 223

Galnt3 Blocking Peptide
33R-7061	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Galnt3 antibody, catalog no. 70R-8653

GALNT3 Conjugated Antibody
C39032	SAB	100ul	EUR 397

GALNT3 cloning plasmid
CSB-CL613501HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 426 Sequence: atggaaaggaacatgaaaaacaaaaacaagatgttggatttaatgctagaagctgtaaacaatattaaggatgccatgccaaaaatgcaaataggagcacctgtcaggcaaaacattgatgctggtgagagaccttgtttgcaaggatattatacagcagcagaattgaagcctgt Show more
Description: A cloning plasmid for the GALNT3 gene.

GALNT3 cloning plasmid
CSB-CL613501HU2-10ug	Cusabio	10ug	EUR 642
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1902 Sequence: atggctcacctaaagcgactagtaaaattacacattaaaagacattaccataaaaagttctggaagcttggtgcagtaatttttttctttataatagttttggttttaatgcaaagagaagtaagtgttcaatattccaaagaggaatcaaggatggaaaggaacatgaaaaaca Show more
Description: A cloning plasmid for the GALNT3 gene.

GALNT3 Rabbit pAb
A6596-100ul	Abclonal	100 ul	EUR 308

GALNT3 Rabbit pAb
A6596-200ul	Abclonal	200 ul	EUR 459

GALNT3 Rabbit pAb
A6596-20ul	Abclonal	20 ul	EUR 183

GALNT3 Rabbit pAb
A6596-50ul	Abclonal	50 ul	EUR 223

Anti-GALNT3 antibody
STJ28679	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities.

Anti-GALNT3 antibody
STJ115920	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities.

Human GALNT3 ELISA KIT
ELI-30947h	Lifescience Market	96 Tests	EUR 824

Mouse GALNT3 shRNA Plasmid
20-abx970458	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GALNT3 shRNA Plasmid
20-abx951726	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Galnt3 ELISA KIT
ELI-47382m	Lifescience Market	96 Tests	EUR 865

GALNT3 Recombinant Protein (Human)
RP012880	ABM	100 ug	Ask for price

GALNT3 Recombinant Protein (Human)
RP039388	ABM	100 ug	Ask for price

GALNT3 Recombinant Protein (Rat)
RP202172	ABM	100 ug	Ask for price

GALNT3 Recombinant Protein (Mouse)
RP135833	ABM	100 ug	Ask for price

Galnt3 ORF Vector (Rat) (pORF)
ORF067392	ABM	1.0 ug DNA	EUR 506

GALNT3 ORF Vector (Human) (pORF)
ORF004294	ABM	1.0 ug DNA	EUR 95

GALNT3 ORF Vector (Human) (pORF)
ORF013130	ABM	1.0 ug DNA	EUR 354

Galnt3 ORF Vector (Mouse) (pORF)
ORF045279	ABM	1.0 ug DNA	EUR 506

Polypeptide N-Acetylgalactosaminyltransferase 3 (GALNT3) Antibody
20-abx005058	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 3 (GALNT3) Antibody
abx034278-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 3 (GALNT3) Antibody
abx034278-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 3 (GALNT3) Antibody
20-abx320751	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Galnt3 sgRNA CRISPR Lentivector set (Rat)
K7322201	ABM	3 x 1.0 ug	EUR 339

Galnt3 sgRNA CRISPR Lentivector set (Mouse)
K4500101	ABM	3 x 1.0 ug	EUR 339

GALNT3 sgRNA CRISPR Lentivector set (Human)
K0835301	ABM	3 x 1.0 ug	EUR 339

Galnt3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7322202	ABM	1.0 ug DNA	EUR 154

Galnt3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7322203	ABM	1.0 ug DNA	EUR 154

Galnt3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7322204	ABM	1.0 ug DNA	EUR 154

Galnt3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4500102	ABM	1.0 ug DNA	EUR 154

Galnt3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4500103	ABM	1.0 ug DNA	EUR 154

Galnt3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4500104	ABM	1.0 ug DNA	EUR 154

GALNT3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0835302	ABM	1.0 ug DNA	EUR 154

GALNT3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0835303	ABM	1.0 ug DNA	EUR 154

GALNT3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0835304	ABM	1.0 ug DNA	EUR 154

GALNT3 Protein Vector (Rat) (pPB-C-His)
PV269566	ABM	500 ng	EUR 603

GALNT3 Protein Vector (Rat) (pPB-N-His)
PV269567	ABM	500 ng	EUR 603

GALNT3 Protein Vector (Rat) (pPM-C-HA)
PV269568	ABM	500 ng	EUR 603

GALNT3 Protein Vector (Rat) (pPM-C-His)
PV269569	ABM	500 ng	EUR 603

GALNT3 Protein Vector (Mouse) (pPB-C-His)
PV181114	ABM	500 ng	EUR 603

GALNT3 Protein Vector (Mouse) (pPB-N-His)
PV181115	ABM	500 ng	EUR 603

GALNT3 Protein Vector (Mouse) (pPM-C-HA)
PV181116	ABM	500 ng	EUR 603

GALNT3 Protein Vector (Mouse) (pPM-C-His)
PV181117	ABM	500 ng	EUR 603

GALNT3 Protein Vector (Human) (pPB-C-His)
PV017173	ABM	500 ng	EUR 329

GALNT3 Protein Vector (Human) (pPB-N-His)
PV017174	ABM	500 ng	EUR 329

GALNT3 Protein Vector (Human) (pPM-C-HA)
PV017175	ABM	500 ng	EUR 329

GALNT3 Protein Vector (Human) (pPM-C-His)
PV017176	ABM	500 ng	EUR 329

GALNT3 Protein Vector (Human) (pPB-C-His)
PV052517	ABM	500 ng	EUR 481

GALNT3 Protein Vector (Human) (pPB-N-His)
PV052518	ABM	500 ng	EUR 481

GALNT3 Protein Vector (Human) (pPM-C-HA)
PV052519	ABM	500 ng	EUR 481

GALNT3 Protein Vector (Human) (pPM-C-His)
PV052520	ABM	500 ng	EUR 481

Galnt3 3'UTR Luciferase Stable Cell Line
TU106886	ABM	1.0 ml	Ask for price

Galnt3 3'UTR GFP Stable Cell Line
TU156886	ABM	1.0 ml	Ask for price

Galnt3 3'UTR Luciferase Stable Cell Line
TU204929	ABM	1.0 ml	Ask for price

Galnt3 3'UTR GFP Stable Cell Line
TU254929	ABM	1.0 ml	Ask for price

GALNT3 3'UTR GFP Stable Cell Line
TU058522	ABM	1.0 ml	EUR 1394