GALNT3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GALNT3. Recognizes GALNT3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Galnt3 antibody

70R-8653 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Galnt3 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA11925 50 ul
EUR 363
Description: Mouse polyclonal to GALNT3


YF-PA11926 50 ug
EUR 363
Description: Mouse polyclonal to GALNT3


YF-PA11927 100 ug
EUR 403
Description: Rabbit polyclonal to GALNT3

GALNT3 Rabbit pAb

A13985-100ul 100 ul
EUR 308

GALNT3 Rabbit pAb

A13985-200ul 200 ul
EUR 459

GALNT3 Rabbit pAb

A13985-20ul 20 ul
EUR 183

GALNT3 Rabbit pAb

A13985-50ul 50 ul
EUR 223

Galnt3 Blocking Peptide

33R-7061 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Galnt3 antibody, catalog no. 70R-8653

GALNT3 Conjugated Antibody

C39032 100ul
EUR 397

GALNT3 cloning plasmid

CSB-CL613501HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 426
  • Sequence: atggaaaggaacatgaaaaacaaaaacaagatgttggatttaatgctagaagctgtaaacaatattaaggatgccatgccaaaaatgcaaataggagcacctgtcaggcaaaacattgatgctggtgagagaccttgtttgcaaggatattatacagcagcagaattgaagcctgt
  • Show more
Description: A cloning plasmid for the GALNT3 gene.

GALNT3 cloning plasmid

CSB-CL613501HU2-10ug 10ug
EUR 642
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1902
  • Sequence: atggctcacctaaagcgactagtaaaattacacattaaaagacattaccataaaaagttctggaagcttggtgcagtaatttttttctttataatagttttggttttaatgcaaagagaagtaagtgttcaatattccaaagaggaatcaaggatggaaaggaacatgaaaaaca
  • Show more
Description: A cloning plasmid for the GALNT3 gene.

GALNT3 Rabbit pAb

A6596-100ul 100 ul
EUR 308

GALNT3 Rabbit pAb

A6596-200ul 200 ul
EUR 459

GALNT3 Rabbit pAb

A6596-20ul 20 ul
EUR 183

GALNT3 Rabbit pAb

A6596-50ul 50 ul
EUR 223

Anti-GALNT3 antibody

STJ28679 100 µl
EUR 277
Description: This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities.

Anti-GALNT3 antibody

STJ115920 100 µl
EUR 277
Description: This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities.


ELI-30947h 96 Tests
EUR 824

Mouse GALNT3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GALNT3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Galnt3 ELISA KIT

ELI-47382m 96 Tests
EUR 865

GALNT3 Recombinant Protein (Human)

RP012880 100 ug Ask for price

GALNT3 Recombinant Protein (Human)

RP039388 100 ug Ask for price

GALNT3 Recombinant Protein (Rat)

RP202172 100 ug Ask for price

GALNT3 Recombinant Protein (Mouse)

RP135833 100 ug Ask for price

Galnt3 ORF Vector (Rat) (pORF)

ORF067392 1.0 ug DNA
EUR 506

GALNT3 ORF Vector (Human) (pORF)

ORF004294 1.0 ug DNA
EUR 95

GALNT3 ORF Vector (Human) (pORF)

ORF013130 1.0 ug DNA
EUR 354

Galnt3 ORF Vector (Mouse) (pORF)

ORF045279 1.0 ug DNA
EUR 506

Polypeptide N-Acetylgalactosaminyltransferase 3 (GALNT3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 3 (GALNT3) Antibody

abx034278-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 3 (GALNT3) Antibody

abx034278-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 3 (GALNT3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Galnt3 sgRNA CRISPR Lentivector set (Rat)

K7322201 3 x 1.0 ug
EUR 339

Galnt3 sgRNA CRISPR Lentivector set (Mouse)

K4500101 3 x 1.0 ug
EUR 339

GALNT3 sgRNA CRISPR Lentivector set (Human)

K0835301 3 x 1.0 ug
EUR 339

Galnt3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7322202 1.0 ug DNA
EUR 154

Galnt3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7322203 1.0 ug DNA
EUR 154

Galnt3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7322204 1.0 ug DNA
EUR 154

Galnt3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4500102 1.0 ug DNA
EUR 154

Galnt3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4500103 1.0 ug DNA
EUR 154

Galnt3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4500104 1.0 ug DNA
EUR 154

GALNT3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0835302 1.0 ug DNA
EUR 154

GALNT3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0835303 1.0 ug DNA
EUR 154

GALNT3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0835304 1.0 ug DNA
EUR 154

GALNT3 Protein Vector (Rat) (pPB-C-His)

PV269566 500 ng
EUR 603

GALNT3 Protein Vector (Rat) (pPB-N-His)

PV269567 500 ng
EUR 603

GALNT3 Protein Vector (Rat) (pPM-C-HA)

PV269568 500 ng
EUR 603

GALNT3 Protein Vector (Rat) (pPM-C-His)

PV269569 500 ng
EUR 603

GALNT3 Protein Vector (Mouse) (pPB-C-His)

PV181114 500 ng
EUR 603

GALNT3 Protein Vector (Mouse) (pPB-N-His)

PV181115 500 ng
EUR 603

GALNT3 Protein Vector (Mouse) (pPM-C-HA)

PV181116 500 ng
EUR 603

GALNT3 Protein Vector (Mouse) (pPM-C-His)

PV181117 500 ng
EUR 603

GALNT3 Protein Vector (Human) (pPB-C-His)

PV017173 500 ng
EUR 329

GALNT3 Protein Vector (Human) (pPB-N-His)

PV017174 500 ng
EUR 329

GALNT3 Protein Vector (Human) (pPM-C-HA)

PV017175 500 ng
EUR 329

GALNT3 Protein Vector (Human) (pPM-C-His)

PV017176 500 ng
EUR 329

GALNT3 Protein Vector (Human) (pPB-C-His)

PV052517 500 ng
EUR 481

GALNT3 Protein Vector (Human) (pPB-N-His)

PV052518 500 ng
EUR 481

GALNT3 Protein Vector (Human) (pPM-C-HA)

PV052519 500 ng
EUR 481

GALNT3 Protein Vector (Human) (pPM-C-His)

PV052520 500 ng
EUR 481

Galnt3 3'UTR Luciferase Stable Cell Line

TU106886 1.0 ml Ask for price

Galnt3 3'UTR GFP Stable Cell Line

TU156886 1.0 ml Ask for price

Galnt3 3'UTR Luciferase Stable Cell Line

TU204929 1.0 ml Ask for price

Galnt3 3'UTR GFP Stable Cell Line

TU254929 1.0 ml Ask for price

GALNT3 3'UTR GFP Stable Cell Line

TU058522 1.0 ml
EUR 1394