Human Growth Hormone 2 (GH2) ELISA Kit

DLR-GH2-Hu-96T 96T
EUR 673
  • Should the Human Growth Hormone 2 (GH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Growth Hormone 2 (GH2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Growth Hormone 2 (GH2) ELISA Kit

RD-GH2-Hu-48Tests 48 Tests
EUR 521

Human Growth Hormone 2 (GH2) ELISA Kit

RD-GH2-Hu-96Tests 96 Tests
EUR 723

Human Growth Hormone 2 (GH2) ELISA Kit

RDR-GH2-Hu-48Tests 48 Tests
EUR 544

Human Growth Hormone 2 (GH2) ELISA Kit

RDR-GH2-Hu-96Tests 96 Tests
EUR 756


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GH2 Antibody

36502-100ul 100ul
EUR 252

GH2 antibody

70R-17474 50 ul
EUR 435
Description: Rabbit polyclonal GH2 antibody

GH2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

GH2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GH2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

GH2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

GH2 Conjugated Antibody

C36502 100ul
EUR 397

GH2 cloning plasmid

CSB-CL009408HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggctgcaggctcccggacgtccctgctcctggcttttggcctgctctgcctgtcctggcttcaagagggcagtgccttcccaaccattcccttatccaggctttttgacaacgctatgctccgcgcccgtcgcctgtaccagctggcatatgacacctatcaggagtttgaaga
  • Show more
Description: A cloning plasmid for the GH2 gene.

anti- GH2 antibody

FNab03448 100µg
EUR 505.25
  • Immunogen: growth hormone 2
  • Uniprot ID: P01242
  • Gene ID: 2689
  • Research Area: Neuroscience, Signal Transduction, Developmental biology
Description: Antibody raised against GH2

GH2 Polyclonal Antibody

A59222 100 µg
EUR 570.55
Description: fast delivery possible

Anti-GH2 antibody

PAab03448 100 ug
EUR 355

Anti-GH2 (1E11)

YF-MA13230 100 ug
EUR 363
Description: Mouse monoclonal to GH2

Anti-GH2 (1D10)

YF-MA13231 100 ug
EUR 363
Description: Mouse monoclonal to GH2

Human GH2 ELISA Kit

EHG0175 96Tests
EUR 521

Goat GH2 ELISA Kit

EGTG0175 96Tests
EUR 521

Canine GH2 ELISA Kit

ECG0175 96Tests
EUR 521

Chicken GH2 ELISA Kit

ECKG0175 96Tests
EUR 521

Bovine GH2 ELISA Kit

EBG0175 96Tests
EUR 521

Anserini GH2 ELISA Kit

EAG0175 96Tests
EUR 521


EF006859 96 Tests
EUR 689

Porcine GH2 ELISA Kit

EPG0175 96Tests
EUR 521


ERG0175 96Tests
EUR 521

Rabbit GH2 ELISA Kit

ERTG0175 96Tests
EUR 521

Sheep GH2 ELISA Kit

ESG0175 96Tests
EUR 521

Mouse GH2 ELISA Kit

EMG0175 96Tests
EUR 521

Monkey GH2 ELISA Kit

EMKG0175 96Tests
EUR 521

Human GH2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GH2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GH2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GH2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GH2 Recombinant Protein (Human)

RP013183 100 ug Ask for price

Guinea Pig GH2 ELISA Kit

EGG0175 96Tests
EUR 521

Growth Hormone 2 (GH2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Growth Hormone 2 (GH2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Growth Hormone 2 (GH2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Growth Hormone 2 (GH2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Growth Hormone 2 (GH2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Growth Hormone 2 (GH2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Growth Hormone 2 (GH2) Antibody

abx233448-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

GH2 Polyclonal Antibody, Biotin Conjugated

A59223 100 µg
EUR 570.55
Description: reagents widely cited

GH2 Polyclonal Antibody, FITC Conjugated

A59224 100 µg
EUR 570.55
Description: Ask the seller for details

GH2 Polyclonal Antibody, HRP Conjugated

A59225 100 µg
EUR 570.55
Description: The best epigenetics products

GH2 ORF Vector (Human) (pORF)

ORF004395 1.0 ug DNA
EUR 95

Recombinant Growth Hormone 2 (GH2)

  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P01242
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Growth Hormone 2 expressed in: E.coli

GH2 ELISA Kit (Human) (OKCD01723)

OKCD01723 96 Wells
EUR 831
Description: Description of target: Plays an important role in growth control. Its major role in stimulating body growth is to stimulate the liver and other tissues to secrete IGF-1. It stimulates both the differentiation and proliferation of myoblasts. It also stimulates amino acid uptake and protein synthesis in muscle and other tissues. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 32 pg/mL

GH2 sgRNA CRISPR Lentivector set (Human)

K0856101 3 x 1.0 ug
EUR 339

Human Growth Hormone 2 (GH2) Protein

  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Growth Hormone 2 (GH2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Growth Hormone 2 (GH2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Growth Hormone 2 (GH2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monkey Growth Hormone 2 (GH2) ELISA Kit

abx360320-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Growth Hormone 2 (GH2) ELISA Kit

abx362033-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Growth Hormone 2 (GH2) ELISA Kit

abx363314-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human GH2(Growth Hormone 2) ELISA Kit

EH3133 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: P01242
  • Alias: GH2/GHL/GHV/GHL/GHVgrowth hormone variant/GH-VPlacenta-specific growth hormone/growth hormone 2hGH-V/placental-specific growth hormone
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml