GH2

Human Growth Hormone 2 (GH2) ELISA Kit

DLR-GH2-Hu-96T 96T
EUR 673.00
  • Should the Human Growth Hormone 2 (GH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Growth Hormone 2 (GH2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Growth Hormone 2 (GH2) ELISA Kit

DL-GH2-Hu-192 1 kit of 192 tests
EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Growth Hormone 2 (GH2)

Human Growth Hormone 2 (GH2) ELISA Kit

DL-GH2-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Growth Hormone 2 (GH2)

Human Growth Hormone 2 (GH2) ELISA Kit

DL-GH2-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Growth Hormone 2 (GH2)

Human Growth Hormone 2 (GH2) ELISA Kit

RDR-GH2-Hu-48Tests 48 Tests
EUR 544.00

Human Growth Hormone 2 (GH2) ELISA Kit

RDR-GH2-Hu-96Tests 96 Tests
EUR 756.00

Human Growth Hormone 2 (GH2) ELISA Kit

RD-GH2-Hu-48Tests 48 Tests
EUR 521.00

Human Growth Hormone 2 (GH2) ELISA Kit

RD-GH2-Hu-96Tests 96 Tests
EUR 723.00

GH2 Antibody

1-CSB-PA009408LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

GH2 Antibody

1-CSB-PA009408GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GH2 Antibody

1-CSB-PA153165
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

GH2 Antibody

36502-100ul 100ul
EUR 252.00

GH2 siRNA

20-abx917848
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GH2 Antibody

1-CSB-PA902740
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

GH2 antibody

70R-17474 50 ul
EUR 435.00
Description: Rabbit polyclonal GH2 antibody

GH2 Conjugated Antibody

C36502 100ul
EUR 397.00

GH2 cloning plasmid

CSB-CL009408HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggctgcaggctcccggacgtccctgctcctggcttttggcctgctctgcctgtcctggcttcaagagggcagtgccttcccaaccattcccttatccaggctttttgacaacgctatgctccgcgcccgtcgcctgtaccagctggcatatgacacctatcaggagtttgaaga
  • Show more
Description: A cloning plasmid for the GH2 gene.

GH2 Polyclonal Antibody

A59222 100 µg
EUR 570.55
Description: fast delivery possible

GH2 Polyclonal Antibody

E-AB-11266-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play
  • Show more
Description: Rabbit antibody against Human GH2 for WB,IHC,ELISA applications.

GH2 Polyclonal Antibody

E-AB-11266-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play
  • Show more
Description: Rabbit antibody against Human GH2 for WB,IHC,ELISA applications.

GH2 Polyclonal Antibody

E-AB-11266-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play
  • Show more
Description: Rabbit antibody against Human GH2 for WB,IHC,ELISA applications.

anti- GH2 antibody

FNab03448 100µg
EUR 505.25
  • Immunogen: growth hormone 2
  • Uniprot ID: P01242
  • Gene ID: 2689
  • Research Area: Neuroscience, Signal Transduction, Developmental biology
Description: Antibody raised against GH2

Anti-GH2 antibody

PAab03448 100 ug
EUR 355.00

Anti-GH2 (1E11)

YF-MA13230 100 ug
EUR 363.00
Description: Mouse monoclonal to GH2

Anti-GH2 (1D10)

YF-MA13231 100 ug
EUR 363.00
Description: Mouse monoclonal to GH2

GH2 Antibody, Biotin conjugated

1-CSB-PA009408LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GH2 Antibody, HRP conjugated

1-CSB-PA009408LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GH2 Antibody, FITC conjugated

1-CSB-PA009408LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GH2. Recognizes GH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

Human GH2 shRNA Plasmid

20-abx951792
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Sheep GH2 ELISA Kit

ESG0175 96Tests
EUR 521.00

Rat GH2 ELISA Kit

ERG0175 96Tests
EUR 521.00

Rabbit GH2 ELISA Kit

ERTG0175 96Tests
EUR 521.00

Mouse GH2 ELISA Kit

EMG0175 96Tests
EUR 521.00

Monkey GH2 ELISA Kit

EMKG0175 96Tests
EUR 521.00

Porcine GH2 ELISA Kit

EPG0175 96Tests
EUR 521.00

Goat GH2 ELISA Kit

EGTG0175 96Tests
EUR 521.00

Anserini GH2 ELISA Kit

EAG0175 96Tests
EUR 521.00

Bovine GH2 ELISA Kit

EBG0175 96Tests
EUR 521.00

Human GH2 ELISA Kit

EHG0175 96Tests
EUR 521.00

Canine GH2 ELISA Kit

ECG0175 96Tests
EUR 521.00

Chicken GH2 ELISA Kit

ECKG0175 96Tests
EUR 521.00

GH2 ELISA KIT|Human

EF006859 96 Tests
EUR 689.00

GH2 Recombinant Protein (Human)

RP013183 100 ug Ask for price

Growth Hormone 2 (GH2) Antibody

20-abx128420
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Growth Hormone 2 (GH2) Antibody

20-abx112865
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

GH2 Polyclonal Antibody, Biotin Conjugated

A59223 100 µg
EUR 570.55
Description: reagents widely cited

GH2 Polyclonal Antibody, FITC Conjugated

A59224 100 µg
EUR 570.55
Description: Ask the seller for details

GH2 Polyclonal Antibody, HRP Conjugated

A59225 100 µg
EUR 570.55
Description: The best epigenetics products

Growth Hormone 2 (GH2) Antibody

20-abx318349
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Growth Hormone 2 (GH2) Antibody

20-abx211236
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Growth Hormone 2 (GH2) Antibody

20-abx211237
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Growth Hormone 2 (GH2) Antibody

20-abx172697
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Growth Hormone 2 (GH2) Antibody

abx233448-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Guinea Pig GH2 ELISA Kit

EGG0175 96Tests
EUR 521.00

GH2 ORF Vector (Human) (pORF)

ORF004395 1.0 ug DNA
EUR 95.00

Recombinant Growth Hormone 2 (GH2)

4-RPC923Hu01
  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P01242
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Growth Hormone 2 expressed in: E.coli

Human Growth Hormone 2 (GH2) Protein

20-abx166821
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Growth Hormone 2 (GH2) Antibody (HRP)

20-abx303958
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Growth Hormone 2 (GH2) Antibody (FITC)

20-abx303959
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Growth Hormone 2 (GH2) Antibody (Biotin)

20-abx303960
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.