GMDS

GMDS antibody

10R-4219 100 ul
EUR 726.00
Description: Mouse monoclonal GMDS antibody

GMDS siRNA

20-abx918105
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GMDS siRNA

20-abx918106
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GMDS Antibody

45988-100ul 100ul
EUR 252.00

GMDS Antibody

45988-50ul 50ul
EUR 187.00

GMDS antibody

70R-17510 50 ul
EUR 435.00
Description: Rabbit polyclonal GMDS antibody

GMDS antibody

70R-13484 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal GMDS antibody

GMDS Antibody

1-CSB-PA009569GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GMDS Antibody

1-CSB-PA009569LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

GMDS Antibody

DF9530 200ul
EUR 304.00
Description: GMDS Antibody detects endogenous levels of total GMDS.

anti-GMDS

YF-PA12047 100 ug
EUR 403.00
Description: Rabbit polyclonal to GMDS

anti-GMDS

YF-PA12048 100 ug
EUR 403.00
Description: Rabbit polyclonal to GMDS

GMDS Polyclonal Antibody

ABP58648-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human GMDS protein
  • Applications tips:
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein

GMDS Polyclonal Antibody

ABP58648-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human GMDS protein
  • Applications tips:
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein

GMDS Polyclonal Antibody

ABP58648-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human GMDS protein
  • Applications tips:
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein

GMDS Polyclonal Antibody

A69515 100 ?g
EUR 628.55
Description: fast delivery possible

Human GMDS Antibody

32687-05111 150 ug
EUR 261.00

GMDS Conjugated Antibody

C45988 100ul
EUR 397.00

anti- GMDS antibody

FNab03521 100µg
EUR 505.25
  • Immunogen: GDP-mannose 4,6-dehydratase
  • Uniprot ID: O60547
  • Gene ID: 2762
  • Research Area: Metabolism
Description: Antibody raised against GMDS

GMDS Rabbit pAb

A15060-100ul 100 ul
EUR 308.00

GMDS Rabbit pAb

A15060-200ul 200 ul
EUR 459.00

GMDS Rabbit pAb

A15060-20ul 20 ul
EUR 183.00

GMDS Rabbit pAb

A15060-50ul 50 ul
EUR 223.00

GMDS Polyclonal Antibody

ES9672-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against GMDS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GMDS Polyclonal Antibody

ES9672-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against GMDS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GMDS cloning plasmid

CSB-CL009569HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1119
  • Sequence: atggcacacgcaccggcacgctgccccagcgcccggggctccggggacggcgagatgggcaagcccaggaacgtggcgctcatcaccggtatcacaggccaggatggttcctacctggctgagttcctgctggagaaaggctatgaggtccatggaattgtacggcggtccagtt
  • Show more
Description: A cloning plasmid for the GMDS gene.

GMDS Blocking Peptide

DF9530-BP 1mg
EUR 195.00

Anti-GMDS antibody

PAab03521 100 ug
EUR 355.00

Anti-GMDS antibody

STJ117254 100 µl
EUR 277.00

Anti-GMDS antibody

STJ190830 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to GMDS

GMDS ELISA KIT|Human

EF009896 96 Tests
EUR 689.00

Mouse GMDS shRNA Plasmid

20-abx981179
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GMDS shRNA Plasmid

20-abx951834
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GMDS Antibody, HRP conjugated

1-CSB-PA009569LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GMDS Antibody, FITC conjugated

1-CSB-PA009569LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GMDS Antibody, Biotin conjugated

1-CSB-PA009569LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GMDS Recombinant Protein (Human)

RP013414 100 ug Ask for price

GMDS Recombinant Protein (Mouse)

RP138836 100 ug Ask for price

GMDS Recombinant Protein (Rat)

RP202892 100 ug Ask for price

GMDS Polyclonal Antibody, HRP Conjugated

A69516 100 ?g
EUR 628.55
Description: reagents widely cited

GMDS Polyclonal Antibody, FITC Conjugated

A69517 100 ?g
EUR 628.55
Description: Ask the seller for details

GMDS Polyclonal Antibody, Biotin Conjugated

A69518 100 ?g
EUR 628.55
Description: The best epigenetics products

Human GMDS Antibody (Biotin Conjugate)

32687-05121 150 ug
EUR 369.00

GMDS ORF Vector (Human) (pORF)

ORF004472 1.0 ug DNA
EUR 95.00

Gmds ORF Vector (Mouse) (pORF)

ORF046280 1.0 ug DNA
EUR 506.00

Gmds ORF Vector (Rat) (pORF)

ORF067632 1.0 ug DNA
EUR 506.00

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody

abx036013-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Human GMDS AssayLite Antibody (FITC Conjugate)

32687-05141 150 ug
EUR 428.00

Human GMDS AssayLite Antibody (RPE Conjugate)

32687-05151 150 ug
EUR 428.00

Human GMDS AssayLite Antibody (APC Conjugate)

32687-05161 150 ug
EUR 428.00

Human GMDS AssayLite Antibody (PerCP Conjugate)

32687-05171 150 ug
EUR 471.00

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody

20-abx334170
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody

20-abx112693
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody

20-abx215645
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody

abx233521-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

GMDS sgRNA CRISPR Lentivector set (Human)

K0872601 3 x 1.0 ug
EUR 339.00

Gmds sgRNA CRISPR Lentivector set (Rat)

K7463601 3 x 1.0 ug
EUR 339.00

Gmds sgRNA CRISPR Lentivector set (Mouse)

K4094301 3 x 1.0 ug
EUR 339.00

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody (HRP)

20-abx335799
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody (FITC)

20-abx335800
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.