GMDS

GMDS siRNA
20-abx918105	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GMDS siRNA
20-abx918106	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GMDS Antibody
45988-100ul	SAB	100ul	EUR 252

GMDS Antibody
45988-50ul	SAB	50ul	EUR 187

GMDS antibody
10R-4219	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal GMDS antibody

GMDS antibody
70R-17510	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GMDS antibody

GMDS antibody
70R-13484	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GMDS antibody

GMDS Antibody
DF9530	Affbiotech	200ul	EUR 304
Description: GMDS Antibody detects endogenous levels of total GMDS.

GMDS Antibody
1-CSB-PA009569GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GMDS Antibody
1-CSB-PA009569LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

anti-GMDS
YF-PA12047	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to GMDS

anti-GMDS
YF-PA12048	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to GMDS

GMDS Conjugated Antibody
C45988	SAB	100ul	EUR 397

GMDS cloning plasmid
CSB-CL009569HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1119 Sequence: atggcacacgcaccggcacgctgccccagcgcccggggctccggggacggcgagatgggcaagcccaggaacgtggcgctcatcaccggtatcacaggccaggatggttcctacctggctgagttcctgctggagaaaggctatgaggtccatggaattgtacggcggtccagtt Show more
Description: A cloning plasmid for the GMDS gene.

anti- GMDS antibody
FNab03521	FN Test	100µg	EUR 505.25
Immunogen: GDP-mannose 4,6-dehydratase Uniprot ID: O60547 Gene ID: 2762 Research Area: Metabolism
Description: Antibody raised against GMDS

GMDS Polyclonal Antibody
ES9672-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GMDS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GMDS Polyclonal Antibody
ES9672-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GMDS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GMDS Polyclonal Antibody
ABP58648-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human GMDS protein Applications tips:
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein

GMDS Polyclonal Antibody
ABP58648-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human GMDS protein Applications tips:
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein

GMDS Polyclonal Antibody
ABP58648-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GMDS protein Applications tips:
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein

GMDS Rabbit pAb
A15060-100ul	Abclonal	100 ul	EUR 308

GMDS Rabbit pAb
A15060-200ul	Abclonal	200 ul	EUR 459

GMDS Rabbit pAb
A15060-20ul	Abclonal	20 ul	EUR 183

GMDS Rabbit pAb
A15060-50ul	Abclonal	50 ul	EUR 223

GMDS Polyclonal Antibody
A69515	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

Human GMDS Antibody
32687-05111	AssayPro	150 ug	EUR 261

GMDS Blocking Peptide
DF9530-BP	Affbiotech	1mg	EUR 195

Anti-GMDS antibody
PAab03521	Lifescience Market	100 ug	EUR 355

Anti-GMDS antibody
STJ117254	St John's Laboratory	100 µl	EUR 277

Anti-GMDS antibody
STJ190830	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GMDS

Mouse GMDS shRNA Plasmid
20-abx981179	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GMDS ELISA KIT|Human
EF009896	Lifescience Market	96 Tests	EUR 689

Human GMDS shRNA Plasmid
20-abx951834	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GMDS Antibody, HRP conjugated
1-CSB-PA009569LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GMDS Antibody, FITC conjugated
1-CSB-PA009569LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GMDS Antibody, Biotin conjugated
1-CSB-PA009569LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GMDS Recombinant Protein (Human)
RP013414	ABM	100 ug	Ask for price

GMDS Recombinant Protein (Rat)
RP202892	ABM	100 ug	Ask for price

GMDS Recombinant Protein (Mouse)
RP138836	ABM	100 ug	Ask for price

GMDS Polyclonal Antibody, HRP Conjugated
A69516	EpiGentek	100 ?g	EUR 628.55
Description: reagents widely cited

GMDS Polyclonal Antibody, FITC Conjugated
A69517	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

GMDS Polyclonal Antibody, Biotin Conjugated
A69518	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

Human GMDS Antibody (Biotin Conjugate)
32687-05121	AssayPro	150 ug	EUR 369

GMDS ORF Vector (Human) (pORF)
ORF004472	ABM	1.0 ug DNA	EUR 95

Gmds ORF Vector (Rat) (pORF)
ORF067632	ABM	1.0 ug DNA	EUR 506

Gmds ORF Vector (Mouse) (pORF)
ORF046280	ABM	1.0 ug DNA	EUR 506

GMDS sgRNA CRISPR Lentivector set (Human)
K0872601	ABM	3 x 1.0 ug	EUR 339

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody
20-abx112693	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody
abx036013-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody
20-abx215645	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody
20-abx334170	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody
abx233521-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Human GMDS AssayLite Antibody (FITC Conjugate)
32687-05141	AssayPro	150 ug	EUR 428

Human GMDS AssayLite Antibody (RPE Conjugate)
32687-05151	AssayPro	150 ug	EUR 428

Human GMDS AssayLite Antibody (APC Conjugate)
32687-05161	AssayPro	150 ug	EUR 428

Human GMDS AssayLite Antibody (PerCP Conjugate)
32687-05171	AssayPro	150 ug	EUR 471

Gmds sgRNA CRISPR Lentivector set (Mouse)
K4094301	ABM	3 x 1.0 ug	EUR 339

Gmds sgRNA CRISPR Lentivector set (Rat)
K7463601	ABM	3 x 1.0 ug	EUR 339

GMDS sgRNA CRISPR Lentivector (Human) (Target 1)
K0872602	ABM	1.0 ug DNA	EUR 154

GMDS sgRNA CRISPR Lentivector (Human) (Target 2)
K0872603	ABM	1.0 ug DNA	EUR 154