GMDS

GMDS antibody
70R-13484 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GMDS antibody

GMDS antibody
10R-4219 100 ul
EUR 726
Description: Mouse monoclonal GMDS antibody

GMDS Antibody
45988-100ul 100ul
EUR 252

GMDS Antibody
45988-50ul 50ul
EUR 187

GMDS Antibody
DF9530 200ul
EUR 304
Description: GMDS Antibody detects endogenous levels of total GMDS.

GMDS Antibody
1-CSB-PA009569GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GMDS Antibody
1-CSB-PA009569LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

GMDS siRNA
20-abx918105
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GMDS siRNA
20-abx918106
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GMDS Antibody
ABD9530 100 ug
EUR 438

anti-GMDS
YF-PA12047 100 ug
EUR 403
Description: Rabbit polyclonal to GMDS

anti-GMDS
YF-PA12048 100 ug
EUR 403
Description: Rabbit polyclonal to GMDS

Human GMDS Antibody
32687-05111 150 ug
EUR 261

GMDS Blocking Peptide
DF9530-BP 1mg
EUR 195

GMDS Conjugated Antibody
C45988 100ul
EUR 397

GMDS cloning plasmid
CSB-CL009569HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1119
  • Sequence: atggcacacgcaccggcacgctgccccagcgcccggggctccggggacggcgagatgggcaagcccaggaacgtggcgctcatcaccggtatcacaggccaggatggttcctacctggctgagttcctgctggagaaaggctatgaggtccatggaattgtacggcggtccagtt
  • Show more
Description: A cloning plasmid for the GMDS gene.

GMDS Polyclonal Antibody
A69515 100 ?g
EUR 628.55
Description: fast delivery possible

GMDS Rabbit pAb
A15060-100ul 100 ul
EUR 308

GMDS Rabbit pAb
A15060-200ul 200 ul
EUR 459

GMDS Rabbit pAb
A15060-20ul 20 ul
EUR 183

GMDS Rabbit pAb
A15060-50ul 50 ul
EUR 223

GMDS Polyclonal Antibody
ABP58648-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GMDS protein
  • Applications tips:
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein

GMDS Polyclonal Antibody
ABP58648-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GMDS protein
  • Applications tips:
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein

GMDS Polyclonal Antibody
ABP58648-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GMDS protein
  • Applications tips:
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein

GMDS Polyclonal Antibody
ES9672-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GMDS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GMDS Polyclonal Antibody
ES9672-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GMDS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- GMDS antibody
FNab03521 100µg
EUR 505.25
  • Immunogen: GDP-mannose 4,6-dehydratase
  • Uniprot ID: O60547
  • Gene ID: 2762
  • Research Area: Metabolism
Description: Antibody raised against GMDS

Anti-GMDS antibody
PAab03521 100 ug
EUR 355

Anti-GMDS antibody
STJ117254 100 µl
EUR 277

Anti-GMDS antibody
STJ190830 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GMDS

GMDS ELISA KIT|Human
EF009896 96 Tests
EUR 689

GMDS Antibody, HRP conjugated
1-CSB-PA009569LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GMDS Antibody, FITC conjugated
1-CSB-PA009569LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GMDS Antibody, Biotin conjugated
1-CSB-PA009569LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GMDS shRNA Plasmid
20-abx951834
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GMDS shRNA Plasmid
20-abx981179
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GMDS Recombinant Protein (Human)
RP013414 100 ug Ask for price

GMDS Recombinant Protein (Rat)
RP202892 100 ug Ask for price

GMDS Recombinant Protein (Mouse)
RP138836 100 ug Ask for price

Human GMDS Antibody (Biotin Conjugate)
32687-05121 150 ug
EUR 369

GMDS Polyclonal Antibody, HRP Conjugated
A69516 100 ?g
EUR 628.55
Description: reagents widely cited

GMDS Polyclonal Antibody, FITC Conjugated
A69517 100 ?g
EUR 628.55
Description: Ask the seller for details

GMDS Polyclonal Antibody, Biotin Conjugated
A69518 100 ?g
EUR 628.55
Description: The best epigenetics products

Gmds ORF Vector (Rat) (pORF)
ORF067632 1.0 ug DNA
EUR 506

GMDS ORF Vector (Human) (pORF)
ORF004472 1.0 ug DNA
EUR 95

Gmds ORF Vector (Mouse) (pORF)
ORF046280 1.0 ug DNA
EUR 506

Human GMDS AssayLite Antibody (FITC Conjugate)
32687-05141 150 ug
EUR 428

Human GMDS AssayLite Antibody (RPE Conjugate)
32687-05151 150 ug
EUR 428

Human GMDS AssayLite Antibody (APC Conjugate)
32687-05161 150 ug
EUR 428

Human GMDS AssayLite Antibody (PerCP Conjugate)
32687-05171 150 ug
EUR 471

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody
20-abx215645
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody
20-abx112693
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody
abx036013-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody
abx233521-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody
20-abx334170
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gmds sgRNA CRISPR Lentivector set (Rat)
K7463601 3 x 1.0 ug
EUR 339

Gmds sgRNA CRISPR Lentivector set (Mouse)
K4094301 3 x 1.0 ug
EUR 339

GMDS sgRNA CRISPR Lentivector set (Human)
K0872601 3 x 1.0 ug
EUR 339

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody (HRP)
20-abx335799
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody (FITC)
20-abx335800
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.