GNE Antibody

35207-100ul 100ul
EUR 252

GNE Antibody

35207-50ul 50ul
EUR 187

GNE Antibody

CSB-PA956478-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GNE. Recognizes GNE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

GNE Antibody

CSB-PA956478-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GNE. Recognizes GNE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

GNE 477

B1657-25
EUR 669

GNE 477

B1657-5
EUR 213

GNE-317

B1716-25
EUR 588

GNE-317

B1716-5
EUR 185

GNE-272

B2533-1
EUR 142

GNE-272

B2533-5
EUR 414

GNE-7915

B3605-100 100 mg
EUR 595
Description: GNE-7915 is a highly potent, selective, and brain-penetrable leucine-rich repeat kinase2 (LRRK2) inhibitor, with Ki and IC50 of 1 nM and 9 nM, respectively.GEN-7915 is extensive inhibitor across 187 screened kinases, except TTK kinase.

GNE-7915

B3605-25 25 mg
EUR 282
Description: GNE-7915 is a highly potent, selective, and brain-penetrable leucine-rich repeat kinase2 (LRRK2) inhibitor, with Ki and IC50 of 1 nM and 9 nM, respectively.GEN-7915 is extensive inhibitor across 187 screened kinases, except TTK kinase.

GNE-7915

B3605-5 5 mg
EUR 119
Description: GNE-7915 is a highly potent, selective, and brain-penetrable leucine-rich repeat kinase2 (LRRK2) inhibitor, with Ki and IC50 of 1 nM and 9 nM, respectively.GEN-7915 is extensive inhibitor across 187 screened kinases, except TTK kinase.

GNE-7915

B3605-5.1 10 mM (in 1mL DMSO)
EUR 180
Description: GNE-7915 is a highly potent, selective, and brain-penetrable leucine-rich repeat kinase2 (LRRK2) inhibitor, with Ki and IC50 of 1 nM and 9 nM, respectively.GEN-7915 is extensive inhibitor across 187 screened kinases, except TTK kinase.

GNE-9605

B4761-25 25 mg
EUR 453
Description: GNE-9605 is a potent and selective inhibitor of LRRK2 with IC50 value of 19 nM [1]. Leucine-rich repeat kinase 2 (LRRK2) is a member of the leucine-rich repeat kinase family.

GNE-9605

B4761-5 5 mg
EUR 177
Description: GNE-9605 is a potent and selective inhibitor of LRRK2 with IC50 value of 19 nM [1]. Leucine-rich repeat kinase 2 (LRRK2) is a member of the leucine-rich repeat kinase family.

GNE-9605

B4761-5.1 10 mM (in 1mL DMSO)
EUR 235
Description: GNE-9605 is a potent and selective inhibitor of LRRK2 with IC50 value of 19 nM [1]. Leucine-rich repeat kinase 2 (LRRK2) is a member of the leucine-rich repeat kinase family.

GNE-317

B4991-100 100 mg
EUR 574
Description: GNE-317 is a potent inhibitor of PI3K [1]. Phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) are a series of enzymes and play an important role in cell growth, proliferation, differentiation, survival, motility and intracellular trafficking.

GNE-317

B4991-25 25 mg
EUR 315
Description: GNE-317 is a potent inhibitor of PI3K [1]. Phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) are a series of enzymes and play an important role in cell growth, proliferation, differentiation, survival, motility and intracellular trafficking.

GNE-317

B4991-5 5 mg
EUR 137
Description: GNE-317 is a potent inhibitor of PI3K [1]. Phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) are a series of enzymes and play an important role in cell growth, proliferation, differentiation, survival, motility and intracellular trafficking.

GNE-617

B1271-10 10 mg
EUR 409
Description: GNE-617 is a potent and competitive inhibitor of nicotinamide phosphoribosyltransferase (NAMPT) with IC50 value of 5nM [1].GNE-617 is a potent inhibitor of NAMPT.

GNE-617

B1271-100 100 mg
EUR 1442
Description: GNE-617 is a potent and competitive inhibitor of nicotinamide phosphoribosyltransferase (NAMPT) with IC50 value of 5nM [1].GNE-617 is a potent inhibitor of NAMPT.

GNE-617

B1271-2 2 mg
EUR 200
Description: GNE-617 is a potent and competitive inhibitor of nicotinamide phosphoribosyltransferase (NAMPT) with IC50 value of 5nM [1].GNE-617 is a potent inhibitor of NAMPT.

GNE-617

B1271-5 5 mg
EUR 282
Description: GNE-617 is a potent and competitive inhibitor of nicotinamide phosphoribosyltransferase (NAMPT) with IC50 value of 5nM [1].GNE-617 is a potent inhibitor of NAMPT.

GNE-617

B1271-5.1 10 mM (in 1mL DMSO)
EUR 432
Description: GNE-617 is a potent and competitive inhibitor of nicotinamide phosphoribosyltransferase (NAMPT) with IC50 value of 5nM [1].GNE-617 is a potent inhibitor of NAMPT.

GNE-617

B1271-50 50 mg
EUR 989
Description: GNE-617 is a potent and competitive inhibitor of nicotinamide phosphoribosyltransferase (NAMPT) with IC50 value of 5nM [1].GNE-617 is a potent inhibitor of NAMPT.

GNE-3511

B1341-25
EUR 1191

GNE-3511

B1341-5
EUR 349

GNE-7915

B1342-25
EUR 648

GNE-7915

B1342-5
EUR 207

GNE Antibody

DF4690 200ul
EUR 304
Description: GNE Antibody detects endogenous levels of total GNE.

GNE Antibody

1-CSB-PA006365
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GNE. Recognizes GNE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

GNE-493

B8000-10 10 mg
EUR 685
Description: GNE-493 is a potent, selective, and orally available dual pan-PI3K/mTOR inhibitor with IC50s of 3.4/12/16/16/32 nM for PI3K?/PI3K?/PI3K?/PI3K?/mTOR respectively.

GNE-493

B8000-5 5 mg
EUR 537
Description: GNE-493 is a potent, selective, and orally available dual pan-PI3K/mTOR inhibitor with IC50s of 3.4/12/16/16/32 nM for PI3K?/PI3K?/PI3K?/PI3K?/mTOR respectively.

GNE-493

B8000-5.1 10 mM (in 1mL DMSO)
EUR 630
Description: GNE-493 is a potent, selective, and orally available dual pan-PI3K/mTOR inhibitor with IC50s of 3.4/12/16/16/32 nM for PI3K?/PI3K?/PI3K?/PI3K?/mTOR respectively.

GNE-477

B8001-1 1 mg
EUR 293
Description: IC50: 4 and 21 nmol/L for PI3K and mTOR, respectivelyGNE-477 is a potent dual PI3K/mTOR inhibitor.

GNE-477

B8001-5 5 mg
EUR 531
Description: IC50: 4 and 21 nmol/L for PI3K and mTOR, respectivelyGNE-477 is a potent dual PI3K/mTOR inhibitor.

GNE siRNA

20-abx902225
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNE siRNA

20-abx918184
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNE siRNA

20-abx918185
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNE Antibody

ABD4690 100 ug
EUR 438

GNE-495

HY-100343 5mg
EUR 187

GNE-6640

HY-112937 25mg
EUR 899

GNE-207

HY-120028 5mg
EUR 1175

GNE-9605

HY-12282 100mg
EUR 1714

GNE 2861

HY-12632 50mg
EUR 625

GNE-317

HY-12763 100mg
EUR 762

GNE-3511

HY-12947 100mg
EUR 1345

GNE-617

HY-15766 2mg
EUR 229

GNE-7915

HY-18163 25mg
EUR 214

GNE-6468

HY-19775 250mg
EUR 6191

GNE-272

HY-100726 100mg
EUR 2116

GNE-6776

HY-107986 5mg
EUR 302

GNE-493

HY-10811 5mg
EUR 452

GNE-049

HY-108435 10mg
EUR 1025

GNE-781

HY-108696 100mg
EUR 3896

GNE-477

HY-11042 25mg
EUR 785

GNE 220

HY-U00428 25mg
EUR 3035

GNE-131

HY-112279 10mg
EUR 796

GNE cloning plasmid

CSB-CL897458HU-10ug 10ug
EUR 717
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2169
  • Sequence: ATGGAGAAGAATGGAAATAACCGAAAGCTGCGGGTTTGTGTTGCTACTTGTAACCGTGCAGATTATTCTAAACTTGCCCCGATCATGTTTGGCATTAAAACCGAACCTGAGTTCTTTGAACTTGATGTTGTGGTACTTGGCTCTCACCTGATAGATGACTATGGAAATACATATC
  • Show more
Description: A cloning plasmid for the GNE gene.