GNG3

GNG3 siRNA

20-abx918197
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG3 Antibody

DF9559 200ul
EUR 304.00
Description: GNG3 Antibody detects endogenous levels of total GNG3.

GNG3 Antibody

ABD9559 100 ug
EUR 438.00

GNG3 Antibody

46005-100ul 100ul
EUR 252.00

GNG3 Antibody

46005-50ul 50ul
EUR 187.00

GNG3 Conjugated Antibody

C46005 100ul
EUR 397.00

GNG3 cloning plasmid

CSB-CL009615HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 228
  • Sequence: atgaaaggtgagaccccggtgaacagcactatgagtattgggcaagcacgcaagatggtggaacagcttaagattgaagccagcttgtgtcggataaaggtgtccaaggcagcagcagacctgatgacttactgtgatgcccacgcctgtgaggatcccctcatcacccctgtgcc
  • Show more
Description: A cloning plasmid for the GNG3 gene.

GNG3 Blocking Peptide

DF9559-BP 1mg
EUR 195.00

GNG3 Rabbit pAb

A9817-100ul 100 ul
EUR 308.00

GNG3 Rabbit pAb

A9817-200ul 200 ul
EUR 459.00

GNG3 Rabbit pAb

A9817-20ul 20 ul
EUR 183.00

GNG3 Rabbit pAb

A9817-50ul 50 ul
EUR 223.00

Anti-GNG3 antibody

STJ111859 100 µl
EUR 277.00
Description: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The gamma subunit determines the specificity of which signaling pathways will be affected by this particular complex. The protein encoded by this gene represents the gamma subunit of both inhibitory and stimulatory complexes.

Mouse GNG3 shRNA Plasmid

20-abx970597
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNG3 shRNA Plasmid

20-abx951857
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine GNG3 ELISA KIT

ELI-31250b 96 Tests
EUR 928.00

Human GNG3 ELISA KIT

ELI-31251h 96 Tests
EUR 824.00

Mouse Gng3 ELISA KIT

ELI-43248m 96 Tests
EUR 865.00

GNG3 Recombinant Protein (Rat)

RP203024 100 ug Ask for price

GNG3 Recombinant Protein (Human)

RP013546 100 ug Ask for price

GNG3 Recombinant Protein (Mouse)

RP139028 100 ug Ask for price

Polyclonal GNG3 Antibody (C-Term)

AMM04832G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNG3 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal GNG3 Antibody - middle region

AMM04834G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNG3 - middle region. This antibody is tested and proven to work in the following applications:

GNG3 ORF Vector (Human) (pORF)

ORF004516 1.0 ug DNA
EUR 95.00

Gng3 ORF Vector (Rat) (pORF)

ORF067676 1.0 ug DNA
EUR 506.00

Gng3 ORF Vector (Mouse) (pORF)

ORF046344 1.0 ug DNA
EUR 506.00

Gng3 sgRNA CRISPR Lentivector set (Rat)

K6999201 3 x 1.0 ug
EUR 339.00

Gng3 sgRNA CRISPR Lentivector set (Mouse)

K4902801 3 x 1.0 ug
EUR 339.00

GNG3 sgRNA CRISPR Lentivector set (Human)

K0876701 3 x 1.0 ug
EUR 339.00

Gng3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6999202 1.0 ug DNA
EUR 154.00

Gng3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6999203 1.0 ug DNA
EUR 154.00

Gng3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6999204 1.0 ug DNA
EUR 154.00

Gng3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4902802 1.0 ug DNA
EUR 154.00

Gng3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4902803 1.0 ug DNA
EUR 154.00

Gng3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4902804 1.0 ug DNA
EUR 154.00

GNG3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0876702 1.0 ug DNA
EUR 154.00

GNG3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0876703 1.0 ug DNA
EUR 154.00

GNG3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0876704 1.0 ug DNA
EUR 154.00

GNG3 Protein Vector (Human) (pPB-C-His)

PV018061 500 ng
EUR 329.00

GNG3 Protein Vector (Human) (pPB-N-His)

PV018062 500 ng
EUR 329.00

GNG3 Protein Vector (Human) (pPM-C-HA)

PV018063 500 ng
EUR 329.00

GNG3 Protein Vector (Human) (pPM-C-His)

PV018064 500 ng
EUR 329.00

GNG3 Protein Vector (Mouse) (pPB-C-His)

PV185374 500 ng
EUR 603.00

GNG3 Protein Vector (Mouse) (pPB-N-His)

PV185375 500 ng
EUR 603.00

GNG3 Protein Vector (Mouse) (pPM-C-HA)

PV185376 500 ng
EUR 603.00

GNG3 Protein Vector (Mouse) (pPM-C-His)

PV185377 500 ng
EUR 603.00

GNG3 Protein Vector (Rat) (pPB-C-His)

PV270702 500 ng
EUR 603.00

GNG3 Protein Vector (Rat) (pPB-N-His)

PV270703 500 ng
EUR 603.00

GNG3 Protein Vector (Rat) (pPM-C-HA)

PV270704 500 ng
EUR 603.00

GNG3 Protein Vector (Rat) (pPM-C-His)

PV270705 500 ng
EUR 603.00

GNG3 3'UTR Luciferase Stable Cell Line

TU008992 1.0 ml
EUR 1394.00

Gng3 3'UTR GFP Stable Cell Line

TU255229 1.0 ml Ask for price

Gng3 3'UTR Luciferase Stable Cell Line

TU108870 1.0 ml Ask for price

Gng3 3'UTR GFP Stable Cell Line

TU158870 1.0 ml Ask for price

GNG3 3'UTR GFP Stable Cell Line

TU058992 1.0 ml
EUR 1394.00

Gng3 3'UTR Luciferase Stable Cell Line

TU205229 1.0 ml Ask for price

Monoclonal GNG3 Antibody (monoclonal) (M01), Clone: 1E10-1B5

AMM04833G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human GNG3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1E10-1B5. This antibody is applicable in WB, E

GNG3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV626005 1.0 ug DNA
EUR 514.00

GNG3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV626009 1.0 ug DNA
EUR 514.00

GNG3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV626010 1.0 ug DNA
EUR 514.00