GNG3

GNG3 Antibody
46005-50ul	SAB	50ul	EUR 187

GNG3 Antibody
DF9559	Affbiotech	200ul	EUR 304
Description: GNG3 Antibody detects endogenous levels of total GNG3.

GNG3 siRNA
20-abx918196	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNG3 siRNA
20-abx918197	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNG3 Antibody
ABD9559	Lifescience Market	100 ug	EUR 438

GNG3 Blocking Peptide
DF9559-BP	Affbiotech	1mg	EUR 195

GNG3 Conjugated Antibody
C46005	SAB	100ul	EUR 397

GNG3 cloning plasmid
CSB-CL009615HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 228 Sequence: atgaaaggtgagaccccggtgaacagcactatgagtattgggcaagcacgcaagatggtggaacagcttaagattgaagccagcttgtgtcggataaaggtgtccaaggcagcagcagacctgatgacttactgtgatgcccacgcctgtgaggatcccctcatcacccctgtgcc Show more
Description: A cloning plasmid for the GNG3 gene.

GNG3 Rabbit pAb
A9817-100ul	Abclonal	100 ul	EUR 308

GNG3 Rabbit pAb
A9817-200ul	Abclonal	200 ul	EUR 459

GNG3 Rabbit pAb
A9817-20ul	Abclonal	20 ul	EUR 183

GNG3 Rabbit pAb
A9817-50ul	Abclonal	50 ul	EUR 223

Anti-GNG3 antibody
STJ111859	St John's Laboratory	100 µl	EUR 277
Description: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The gamma subunit determines the specificity of which signaling pathways will be affected by this particular complex. The protein encoded by this gene represents the gamma subunit of both inhibitory and stimulatory complexes.

Bovine GNG3 ELISA KIT
ELI-31250b	Lifescience Market	96 Tests	EUR 928

Human GNG3 ELISA KIT
ELI-31251h	Lifescience Market	96 Tests	EUR 824

Mouse Gng3 ELISA KIT
ELI-43248m	Lifescience Market	96 Tests	EUR 865

Human GNG3 shRNA Plasmid
20-abx951857	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GNG3 shRNA Plasmid
20-abx970597	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GNG3 Recombinant Protein (Human)
RP013546	ABM	100 ug	Ask for price

GNG3 Recombinant Protein (Rat)
RP203024	ABM	100 ug	Ask for price

GNG3 Recombinant Protein (Mouse)
RP139028	ABM	100 ug	Ask for price

Polyclonal GNG3 Antibody (C-Term)
AMM04832G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNG3 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal GNG3 Antibody - middle region
AMM04834G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNG3 - middle region. This antibody is tested and proven to work in the following applications:

Gng3 ORF Vector (Rat) (pORF)
ORF067676	ABM	1.0 ug DNA	EUR 506

GNG3 ORF Vector (Human) (pORF)
ORF004516	ABM	1.0 ug DNA	EUR 95

Gng3 ORF Vector (Mouse) (pORF)
ORF046344	ABM	1.0 ug DNA	EUR 506

Gng3 sgRNA CRISPR Lentivector set (Mouse)
K4902801	ABM	3 x 1.0 ug	EUR 339

Gng3 sgRNA CRISPR Lentivector set (Rat)
K6999201	ABM	3 x 1.0 ug	EUR 339

GNG3 sgRNA CRISPR Lentivector set (Human)
K0876701	ABM	3 x 1.0 ug	EUR 339

Gng3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4902802	ABM	1.0 ug DNA	EUR 154

Gng3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4902803	ABM	1.0 ug DNA	EUR 154

Gng3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4902804	ABM	1.0 ug DNA	EUR 154

Gng3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6999202	ABM	1.0 ug DNA	EUR 154

Gng3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6999203	ABM	1.0 ug DNA	EUR 154

Gng3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6999204	ABM	1.0 ug DNA	EUR 154

GNG3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0876702	ABM	1.0 ug DNA	EUR 154

GNG3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0876703	ABM	1.0 ug DNA	EUR 154

GNG3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0876704	ABM	1.0 ug DNA	EUR 154

GNG3 Protein Vector (Rat) (pPB-C-His)
PV270702	ABM	500 ng	EUR 603

GNG3 Protein Vector (Rat) (pPB-N-His)
PV270703	ABM	500 ng	EUR 603

GNG3 Protein Vector (Rat) (pPM-C-HA)
PV270704	ABM	500 ng	EUR 603

GNG3 Protein Vector (Rat) (pPM-C-His)
PV270705	ABM	500 ng	EUR 603

GNG3 Protein Vector (Mouse) (pPB-C-His)
PV185374	ABM	500 ng	EUR 603

GNG3 Protein Vector (Mouse) (pPB-N-His)
PV185375	ABM	500 ng	EUR 603

GNG3 Protein Vector (Mouse) (pPM-C-HA)
PV185376	ABM	500 ng	EUR 603

GNG3 Protein Vector (Mouse) (pPM-C-His)
PV185377	ABM	500 ng	EUR 603

GNG3 Protein Vector (Human) (pPB-C-His)
PV018061	ABM	500 ng	EUR 329

GNG3 Protein Vector (Human) (pPB-N-His)
PV018062	ABM	500 ng	EUR 329

GNG3 Protein Vector (Human) (pPM-C-HA)
PV018063	ABM	500 ng	EUR 329

GNG3 Protein Vector (Human) (pPM-C-His)
PV018064	ABM	500 ng	EUR 329

Gng3 3'UTR Luciferase Stable Cell Line
TU108870	ABM	1.0 ml	Ask for price

Gng3 3'UTR Luciferase Stable Cell Line
TU205229	ABM	1.0 ml	Ask for price

Gng3 3'UTR GFP Stable Cell Line
TU158870	ABM	1.0 ml	Ask for price

Gng3 3'UTR GFP Stable Cell Line
TU255229	ABM	1.0 ml	Ask for price

GNG3 3'UTR GFP Stable Cell Line
TU058992	ABM	1.0 ml	EUR 1394

GNG3 3'UTR Luciferase Stable Cell Line
TU008992	ABM	1.0 ml	EUR 1394

Monoclonal GNG3 Antibody (monoclonal) (M01), Clone: 1E10-1B5
AMM04833G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human GNG3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1E10-1B5. This antibody is applicable in WB, E

GNG3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV626005	ABM	1.0 ug DNA	EUR 514

GNG3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV626009	ABM	1.0 ug DNA	EUR 514

GNG3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV626010	ABM	1.0 ug DNA	EUR 514