GNG3

GNG3 siRNA
20-abx918196
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG3 siRNA
20-abx918197
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG3 Antibody
46005-100ul 100ul
EUR 252

GNG3 Antibody
46005-50ul 50ul
EUR 187

GNG3 Antibody
DF9559 200ul
EUR 304
Description: GNG3 Antibody detects endogenous levels of total GNG3.

GNG3 Conjugated Antibody
C46005 100ul
EUR 397

GNG3 cloning plasmid
CSB-CL009615HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 228
  • Sequence: atgaaaggtgagaccccggtgaacagcactatgagtattgggcaagcacgcaagatggtggaacagcttaagattgaagccagcttgtgtcggataaaggtgtccaaggcagcagcagacctgatgacttactgtgatgcccacgcctgtgaggatcccctcatcacccctgtgcc
  • Show more
Description: A cloning plasmid for the GNG3 gene.

GNG3 Rabbit pAb
A9817-100ul 100 ul
EUR 308

GNG3 Rabbit pAb
A9817-200ul 200 ul
EUR 459

GNG3 Rabbit pAb
A9817-20ul 20 ul
EUR 183

GNG3 Rabbit pAb
A9817-50ul 50 ul
EUR 223

GNG3 Blocking Peptide
DF9559-BP 1mg
EUR 195

Anti-GNG3 antibody
STJ111859 100 µl
EUR 277
Description: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The gamma subunit determines the specificity of which signaling pathways will be affected by this particular complex. The protein encoded by this gene represents the gamma subunit of both inhibitory and stimulatory complexes.

Mouse Gng3 ELISA KIT
ELI-43248m 96 Tests
EUR 865

Bovine GNG3 ELISA KIT
ELI-31250b 96 Tests
EUR 928

Human GNG3 ELISA KIT
ELI-31251h 96 Tests
EUR 824

Mouse GNG3 shRNA Plasmid
20-abx970597
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNG3 shRNA Plasmid
20-abx951857
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNG3 Recombinant Protein (Human)
RP013546 100 ug Ask for price

GNG3 Recombinant Protein (Rat)
RP203024 100 ug Ask for price

GNG3 Recombinant Protein (Mouse)
RP139028 100 ug Ask for price

Polyclonal GNG3 Antibody (C-Term)
AMM04832G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNG3 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal GNG3 Antibody - middle region
AMM04834G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNG3 - middle region. This antibody is tested and proven to work in the following applications:

GNG3 ORF Vector (Human) (pORF)
ORF004516 1.0 ug DNA
EUR 95

Gng3 ORF Vector (Rat) (pORF)
ORF067676 1.0 ug DNA
EUR 506

Gng3 ORF Vector (Mouse) (pORF)
ORF046344 1.0 ug DNA
EUR 506

GNG3 sgRNA CRISPR Lentivector set (Human)
K0876701 3 x 1.0 ug
EUR 339

Gng3 sgRNA CRISPR Lentivector set (Mouse)
K4902801 3 x 1.0 ug
EUR 339

Gng3 sgRNA CRISPR Lentivector set (Rat)
K6999201 3 x 1.0 ug
EUR 339

GNG3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0876702 1.0 ug DNA
EUR 154

GNG3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0876703 1.0 ug DNA
EUR 154

GNG3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0876704 1.0 ug DNA
EUR 154

Gng3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4902802 1.0 ug DNA
EUR 154

Gng3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4902803 1.0 ug DNA
EUR 154

Gng3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4902804 1.0 ug DNA
EUR 154

Gng3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6999202 1.0 ug DNA
EUR 154

Gng3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6999203 1.0 ug DNA
EUR 154

Gng3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6999204 1.0 ug DNA
EUR 154

GNG3 Protein Vector (Mouse) (pPB-C-His)
PV185374 500 ng
EUR 603

GNG3 Protein Vector (Mouse) (pPB-N-His)
PV185375 500 ng
EUR 603

GNG3 Protein Vector (Mouse) (pPM-C-HA)
PV185376 500 ng
EUR 603

GNG3 Protein Vector (Mouse) (pPM-C-His)
PV185377 500 ng
EUR 603

GNG3 Protein Vector (Rat) (pPB-C-His)
PV270702 500 ng
EUR 603

GNG3 Protein Vector (Rat) (pPB-N-His)
PV270703 500 ng
EUR 603

GNG3 Protein Vector (Rat) (pPM-C-HA)
PV270704 500 ng
EUR 603

GNG3 Protein Vector (Rat) (pPM-C-His)
PV270705 500 ng
EUR 603

GNG3 Protein Vector (Human) (pPB-C-His)
PV018061 500 ng
EUR 329

GNG3 Protein Vector (Human) (pPB-N-His)
PV018062 500 ng
EUR 329

GNG3 Protein Vector (Human) (pPM-C-HA)
PV018063 500 ng
EUR 329

GNG3 Protein Vector (Human) (pPM-C-His)
PV018064 500 ng
EUR 329

Gng3 3'UTR Luciferase Stable Cell Line
TU205229 1.0 ml Ask for price

Gng3 3'UTR GFP Stable Cell Line
TU158870 1.0 ml Ask for price

GNG3 3'UTR Luciferase Stable Cell Line
TU008992 1.0 ml
EUR 1394

Gng3 3'UTR Luciferase Stable Cell Line
TU108870 1.0 ml Ask for price

GNG3 3'UTR GFP Stable Cell Line
TU058992 1.0 ml
EUR 1394

Gng3 3'UTR GFP Stable Cell Line
TU255229 1.0 ml Ask for price

Monoclonal GNG3 Antibody (monoclonal) (M01), Clone: 1E10-1B5
AMM04833G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GNG3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1E10-1B5. This antibody is applicable in WB, E

GNG3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV626005 1.0 ug DNA
EUR 514

GNG3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV626009 1.0 ug DNA
EUR 514

GNG3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV626010 1.0 ug DNA
EUR 514