GNG7 Antibody

46008-100ul 100ul
EUR 252

GNG7 Antibody

46008-50ul 50ul
EUR 187

GNG7 Antibody

DF9562 200ul
EUR 304
Description: GNG7 Antibody detects endogenous levels of total GNG7.

GNG7 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG7. Recognizes GNG7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG7 Antibody

ABD9562 100 ug
EUR 438

GNG7 Rabbit pAb

A10009-100ul 100 ul
EUR 308

GNG7 Rabbit pAb

A10009-200ul 200 ul
EUR 459

GNG7 Rabbit pAb

A10009-20ul 20 ul
EUR 183

GNG7 Rabbit pAb

A10009-50ul 50 ul
EUR 223

GNG7 Blocking Peptide

DF9562-BP 1mg
EUR 195

GNG7 Conjugated Antibody

C46008 100ul
EUR 397

GNG7 cloning plasmid

CSB-CL009619HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 207
  • Sequence: atgtcagccactaacaacatagcccaggcccggaagctggtggaacagctacgcatagaagccgggattgagcgcatcaaggtctccaaagcggcgtctgacctcatgagctactgtgagcaacatgcccggaacgaccccctgctggtcggagtccctgcctcggagaacccctt
  • Show more
Description: A cloning plasmid for the GNG7 gene.

GNG7 Polyclonal Antibody

A62678 100 µg
EUR 570.55
Description: kits suitable for this type of research

Anti-GNG7 antibody

STJ112049 100 µl
EUR 277

Mouse Gng7 ELISA KIT

ELI-08151m 96 Tests
EUR 865


ELI-08182h 96 Tests
EUR 824

Rat GNG7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNG7 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG7. Recognizes GNG7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG7 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG7. Recognizes GNG7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG7 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG7. Recognizes GNG7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GNG7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNG7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-37687b 96 Tests
EUR 928

GNG7 Recombinant Protein (Human)

RP013555 100 ug Ask for price

GNG7 Recombinant Protein (Rat)

RP203030 100 ug Ask for price

GNG7 Recombinant Protein (Mouse)

RP139037 100 ug Ask for price

GNG7 Recombinant Protein (Mouse)

RP139040 100 ug Ask for price

GNG7 Polyclonal Antibody, HRP Conjugated

A62679 100 µg
EUR 570.55
Description: fast delivery possible

GNG7 Polyclonal Antibody, FITC Conjugated

A62680 100 µg
EUR 570.55
Description: reagents widely cited

GNG7 Polyclonal Antibody, Biotin Conjugated

A62681 100 µg
EUR 570.55
Description: Ask the seller for details

Gng7 ORF Vector (Rat) (pORF)

ORF067678 1.0 ug DNA
EUR 506

GNG7 ORF Vector (Human) (pORF)

ORF004519 1.0 ug DNA
EUR 95

Gng7 ORF Vector (Mouse) (pORF)

ORF046347 1.0 ug DNA
EUR 506

Gng7 ORF Vector (Mouse) (pORF)

ORF046348 1.0 ug DNA
EUR 506

Gng7 sgRNA CRISPR Lentivector set (Mouse)

K4942401 3 x 1.0 ug
EUR 339

Gng7 sgRNA CRISPR Lentivector set (Rat)

K6925401 3 x 1.0 ug
EUR 339

GNG7 sgRNA CRISPR Lentivector set (Human)

K0877501 3 x 1.0 ug
EUR 339

Gng7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4942402 1.0 ug DNA
EUR 154

Gng7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4942403 1.0 ug DNA
EUR 154

Gng7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4942404 1.0 ug DNA
EUR 154

Gng7 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6925402 1.0 ug DNA
EUR 154

Gng7 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6925403 1.0 ug DNA
EUR 154

Gng7 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6925404 1.0 ug DNA
EUR 154

GNG7 sgRNA CRISPR Lentivector (Human) (Target 1)

K0877502 1.0 ug DNA
EUR 154

GNG7 sgRNA CRISPR Lentivector (Human) (Target 2)

K0877503 1.0 ug DNA
EUR 154

GNG7 sgRNA CRISPR Lentivector (Human) (Target 3)

K0877504 1.0 ug DNA
EUR 154

GNG7 Protein Vector (Rat) (pPB-C-His)

PV270710 500 ng
EUR 603

GNG7 Protein Vector (Rat) (pPB-N-His)

PV270711 500 ng
EUR 603

GNG7 Protein Vector (Rat) (pPM-C-HA)

PV270712 500 ng
EUR 603

GNG7 Protein Vector (Rat) (pPM-C-His)

PV270713 500 ng
EUR 603

GNG7 Protein Vector (Mouse) (pPB-C-His)

PV185386 500 ng
EUR 603

GNG7 Protein Vector (Mouse) (pPB-N-His)

PV185387 500 ng
EUR 603

GNG7 Protein Vector (Mouse) (pPM-C-HA)

PV185388 500 ng
EUR 603

GNG7 Protein Vector (Mouse) (pPM-C-His)

PV185389 500 ng
EUR 603

GNG7 Protein Vector (Mouse) (pPB-C-His)

PV185390 500 ng
EUR 603

GNG7 Protein Vector (Mouse) (pPB-N-His)

PV185391 500 ng
EUR 603

GNG7 Protein Vector (Mouse) (pPM-C-HA)

PV185392 500 ng
EUR 603