GNG7

GNG7 Antibody
1-CSB-PA009619LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG7. Recognizes GNG7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

GNG7 siRNA
20-abx902228
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG7 siRNA
20-abx918202
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG7 siRNA
20-abx918203
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG7 Antibody
DF9562 200ul
EUR 304.00
Description: GNG7 Antibody detects endogenous levels of total GNG7.

GNG7 Antibody
ABD9562 100 ug
EUR 438.00

GNG7 Antibody
46008-100ul 100ul
EUR 252.00

GNG7 Antibody
46008-50ul 50ul
EUR 187.00

GNG7 Conjugated Antibody
C46008 100ul
EUR 397.00

GNG7 cloning plasmid
CSB-CL009619HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 207
  • Sequence: atgtcagccactaacaacatagcccaggcccggaagctggtggaacagctacgcatagaagccgggattgagcgcatcaaggtctccaaagcggcgtctgacctcatgagctactgtgagcaacatgcccggaacgaccccctgctggtcggagtccctgcctcggagaacccctt
  • Show more
Description: A cloning plasmid for the GNG7 gene.

GNG7 Polyclonal Antibody
A62678 100 µg
EUR 570.55
Description: kits suitable for this type of research

GNG7 Blocking Peptide
DF9562-BP 1mg
EUR 195.00

GNG7 Rabbit pAb
A10009-100ul 100 ul
EUR 308.00

GNG7 Rabbit pAb
A10009-200ul 200 ul
EUR 459.00

GNG7 Rabbit pAb
A10009-20ul 20 ul
EUR 183.00

GNG7 Rabbit pAb
A10009-50ul 50 ul
EUR 223.00

Anti-GNG7 antibody
STJ112049 100 µl
EUR 277.00

Rat GNG7 shRNA Plasmid
20-abx985955
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNG7 Antibody, HRP conjugated
1-CSB-PA009619LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG7. Recognizes GNG7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG7 Antibody, FITC conjugated
1-CSB-PA009619LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG7. Recognizes GNG7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG7 Antibody, Biotin conjugated
1-CSB-PA009619LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG7. Recognizes GNG7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse GNG7 shRNA Plasmid
20-abx970601
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNG7 shRNA Plasmid
20-abx951860
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine GNG7 ELISA KIT
ELI-37687b 96 Tests
EUR 928.00

Mouse Gng7 ELISA KIT
ELI-08151m 96 Tests
EUR 865.00

Human GNG7 ELISA KIT
ELI-08182h 96 Tests
EUR 824.00

GNG7 Recombinant Protein (Human)
RP013555 100 ug Ask for price

GNG7 Recombinant Protein (Rat)
RP203030 100 ug Ask for price

GNG7 Recombinant Protein (Mouse)
RP139037 100 ug Ask for price

GNG7 Recombinant Protein (Mouse)
RP139040 100 ug Ask for price

GNG7 Polyclonal Antibody, HRP Conjugated
A62679 100 µg
EUR 570.55
Description: fast delivery possible

GNG7 Polyclonal Antibody, FITC Conjugated
A62680 100 µg
EUR 570.55
Description: reagents widely cited

GNG7 Polyclonal Antibody, Biotin Conjugated
A62681 100 µg
EUR 570.55
Description: Ask the seller for details

GNG7 ORF Vector (Human) (pORF)
ORF004519 1.0 ug DNA
EUR 95.00

Gng7 ORF Vector (Mouse) (pORF)
ORF046347 1.0 ug DNA
EUR 506.00

Gng7 ORF Vector (Mouse) (pORF)
ORF046348 1.0 ug DNA
EUR 506.00

Gng7 ORF Vector (Rat) (pORF)
ORF067678 1.0 ug DNA
EUR 506.00

GNG7 sgRNA CRISPR Lentivector set (Human)
K0877501 3 x 1.0 ug
EUR 339.00

Gng7 sgRNA CRISPR Lentivector set (Rat)
K6925401 3 x 1.0 ug
EUR 339.00

Gng7 sgRNA CRISPR Lentivector set (Mouse)
K4942401 3 x 1.0 ug
EUR 339.00

GNG7 sgRNA CRISPR Lentivector (Human) (Target 1)
K0877502 1.0 ug DNA
EUR 154.00

GNG7 sgRNA CRISPR Lentivector (Human) (Target 2)
K0877503 1.0 ug DNA
EUR 154.00

GNG7 sgRNA CRISPR Lentivector (Human) (Target 3)
K0877504 1.0 ug DNA
EUR 154.00

Gng7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6925402 1.0 ug DNA
EUR 154.00

Gng7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6925403 1.0 ug DNA
EUR 154.00

Gng7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6925404 1.0 ug DNA
EUR 154.00

Gng7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4942402 1.0 ug DNA
EUR 154.00

Gng7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4942403 1.0 ug DNA
EUR 154.00

Gng7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4942404 1.0 ug DNA
EUR 154.00

GNG7 Protein Vector (Rat) (pPB-C-His)
PV270710 500 ng
EUR 603.00

GNG7 Protein Vector (Rat) (pPB-N-His)
PV270711 500 ng
EUR 603.00

GNG7 Protein Vector (Rat) (pPM-C-HA)
PV270712 500 ng
EUR 603.00

GNG7 Protein Vector (Rat) (pPM-C-His)
PV270713 500 ng
EUR 603.00

GNG7 Protein Vector (Mouse) (pPB-C-His)
PV185386 500 ng
EUR 603.00

GNG7 Protein Vector (Mouse) (pPB-N-His)
PV185387 500 ng
EUR 603.00

GNG7 Protein Vector (Mouse) (pPM-C-HA)
PV185388 500 ng
EUR 603.00

GNG7 Protein Vector (Mouse) (pPM-C-His)
PV185389 500 ng
EUR 603.00

GNG7 Protein Vector (Mouse) (pPB-C-His)
PV185390 500 ng
EUR 603.00

GNG7 Protein Vector (Mouse) (pPB-N-His)
PV185391 500 ng
EUR 603.00

GNG7 Protein Vector (Mouse) (pPM-C-HA)
PV185392 500 ng
EUR 603.00