GNG7

GNG7 siRNA
20-abx902228	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNG7 Antibody
ABD9562	Lifescience Market	100 ug	EUR 438

GNG7 siRNA
20-abx918202	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNG7 siRNA
20-abx918203	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNG7 Antibody
46008-100ul	SAB	100ul	EUR 252

GNG7 Antibody
46008-50ul	SAB	50ul	EUR 187

GNG7 Antibody
DF9562	Affbiotech	200ul	EUR 304
Description: GNG7 Antibody detects endogenous levels of total GNG7.

GNG7 Antibody
1-CSB-PA009619LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG7. Recognizes GNG7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

GNG7 Conjugated Antibody
C46008	SAB	100ul	EUR 397

GNG7 cloning plasmid
CSB-CL009619HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 207 Sequence: atgtcagccactaacaacatagcccaggcccggaagctggtggaacagctacgcatagaagccgggattgagcgcatcaaggtctccaaagcggcgtctgacctcatgagctactgtgagcaacatgcccggaacgaccccctgctggtcggagtccctgcctcggagaacccctt Show more
Description: A cloning plasmid for the GNG7 gene.

GNG7 Rabbit pAb
A10009-100ul	Abclonal	100 ul	EUR 308

GNG7 Rabbit pAb
A10009-200ul	Abclonal	200 ul	EUR 459

GNG7 Rabbit pAb
A10009-20ul	Abclonal	20 ul	EUR 183

GNG7 Rabbit pAb
A10009-50ul	Abclonal	50 ul	EUR 223

GNG7 Polyclonal Antibody
A62678	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

GNG7 Blocking Peptide
DF9562-BP	Affbiotech	1mg	EUR 195

Anti-GNG7 antibody
STJ112049	St John's Laboratory	100 µl	EUR 277

Rat GNG7 shRNA Plasmid
20-abx985955	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Gng7 ELISA KIT
ELI-08151m	Lifescience Market	96 Tests	EUR 865

Human GNG7 ELISA KIT
ELI-08182h	Lifescience Market	96 Tests	EUR 824

Bovine GNG7 ELISA KIT
ELI-37687b	Lifescience Market	96 Tests	EUR 928

Mouse GNG7 shRNA Plasmid
20-abx970601	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNG7 shRNA Plasmid
20-abx951860	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GNG7 Antibody, HRP conjugated
1-CSB-PA009619LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG7. Recognizes GNG7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG7 Antibody, FITC conjugated
1-CSB-PA009619LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG7. Recognizes GNG7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG7 Antibody, Biotin conjugated
1-CSB-PA009619LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG7. Recognizes GNG7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNG7 Recombinant Protein (Human)
RP013555	ABM	100 ug	Ask for price

GNG7 Recombinant Protein (Rat)
RP203030	ABM	100 ug	Ask for price

GNG7 Recombinant Protein (Mouse)
RP139037	ABM	100 ug	Ask for price

GNG7 Recombinant Protein (Mouse)
RP139040	ABM	100 ug	Ask for price

GNG7 Polyclonal Antibody, HRP Conjugated
A62679	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

GNG7 Polyclonal Antibody, FITC Conjugated
A62680	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GNG7 Polyclonal Antibody, Biotin Conjugated
A62681	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

GNG7 ORF Vector (Human) (pORF)
ORF004519	ABM	1.0 ug DNA	EUR 95

Gng7 ORF Vector (Rat) (pORF)
ORF067678	ABM	1.0 ug DNA	EUR 506

Gng7 ORF Vector (Mouse) (pORF)
ORF046347	ABM	1.0 ug DNA	EUR 506

Gng7 ORF Vector (Mouse) (pORF)
ORF046348	ABM	1.0 ug DNA	EUR 506

GNG7 sgRNA CRISPR Lentivector set (Human)
K0877501	ABM	3 x 1.0 ug	EUR 339

Gng7 sgRNA CRISPR Lentivector set (Mouse)
K4942401	ABM	3 x 1.0 ug	EUR 339

Gng7 sgRNA CRISPR Lentivector set (Rat)
K6925401	ABM	3 x 1.0 ug	EUR 339

GNG7 sgRNA CRISPR Lentivector (Human) (Target 1)
K0877502	ABM	1.0 ug DNA	EUR 154

GNG7 sgRNA CRISPR Lentivector (Human) (Target 2)
K0877503	ABM	1.0 ug DNA	EUR 154

GNG7 sgRNA CRISPR Lentivector (Human) (Target 3)
K0877504	ABM	1.0 ug DNA	EUR 154

Gng7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4942402	ABM	1.0 ug DNA	EUR 154

Gng7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4942403	ABM	1.0 ug DNA	EUR 154

Gng7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4942404	ABM	1.0 ug DNA	EUR 154

Gng7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6925402	ABM	1.0 ug DNA	EUR 154

Gng7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6925403	ABM	1.0 ug DNA	EUR 154

Gng7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6925404	ABM	1.0 ug DNA	EUR 154

GNG7 Protein Vector (Mouse) (pPB-C-His)
PV185386	ABM	500 ng	EUR 603

GNG7 Protein Vector (Mouse) (pPB-N-His)
PV185387	ABM	500 ng	EUR 603

GNG7 Protein Vector (Mouse) (pPM-C-HA)
PV185388	ABM	500 ng	EUR 603

GNG7 Protein Vector (Mouse) (pPM-C-His)
PV185389	ABM	500 ng	EUR 603

GNG7 Protein Vector (Mouse) (pPB-C-His)
PV185390	ABM	500 ng	EUR 603

GNG7 Protein Vector (Mouse) (pPB-N-His)
PV185391	ABM	500 ng	EUR 603

GNG7 Protein Vector (Mouse) (pPM-C-HA)
PV185392	ABM	500 ng	EUR 603

GNG7 Protein Vector (Mouse) (pPM-C-His)
PV185393	ABM	500 ng	EUR 603

GNG7 Protein Vector (Rat) (pPB-C-His)
PV270710	ABM	500 ng	EUR 603

GNG7 Protein Vector (Rat) (pPB-N-His)
PV270711	ABM	500 ng	EUR 603

GNG7 Protein Vector (Rat) (pPM-C-HA)
PV270712	ABM	500 ng	EUR 603