GPIHBP1

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

DLR-GPIHBP1-Hu-96T 96T
EUR 725.00
  • Should the Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

DL-GPIHBP1-Hu-192 1 kit of 192 tests
EUR 1251.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1)

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

DL-GPIHBP1-Hu-48 1 kit of 48 tests
EUR 517.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1)

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

DL-GPIHBP1-Hu-96 1 kit of 96 tests
EUR 695.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1)

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

RD-GPIHBP1-Hu-48Tests 48 Tests
EUR 563.00

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

RD-GPIHBP1-Hu-96Tests 96 Tests
EUR 783.00

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

RDR-GPIHBP1-Hu-48Tests 48 Tests
EUR 589.00

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

RDR-GPIHBP1-Hu-96Tests 96 Tests
EUR 820.00

GPIHBP1 Antibody

1-CSB-PA811603LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPIHBP1. Recognizes GPIHBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

GPIHBP1 siRNA

20-abx918378
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPIHBP1 siRNA

20-abx918379
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPIHBP1 cloning plasmid

CSB-CL811603HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgaaggcgctcggggctgtcctgcttgccctcttgctgttcgggcggccagggagagggcagacacagcaggaggaagaggaagaggacgaggaccacgggccagatgactacgacgaggaagatgaggatgaggtggaagaggaggagaccaacaggctccctggtggcaggag
  • Show more
Description: A cloning plasmid for the GPIHBP1 gene.

GPIHBP1 cloning plasmid

CSB-CL811603HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: ATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTGCGGGCGGCCAGGGAGAGGGCAGACACAGCAGGAGGAAGAGGAAGAGGACGAGGACCACGGGCCAGATGACTACGACGAGGAAGATGAGGATGAGGTTGAAGAGGAGGAGACCAACAGGCTCCCTGGTGGCAGGAG
  • Show more
Description: A cloning plasmid for the GPIHBP1 gene.

GPIHBP1 Polyclonal Antibody

27968-100ul 100ul
EUR 252.00

GPIHBP1 Polyclonal Antibody

27968-50ul 50ul
EUR 187.00

GPIHBP1 Rabbit pAb

A13240-100ul 100 ul
EUR 308.00

GPIHBP1 Rabbit pAb

A13240-20ul 20 ul
EUR 183.00

GPIHBP1 Rabbit pAb

A13240-200ul 200 ul
EUR 459.00

GPIHBP1 Rabbit pAb

A13240-50ul 50 ul
EUR 223.00

pCMV-SPORT6-GPIHBP1

PVT14518 2 ug
EUR 495.00

Anti-GPIHBP1 antibody

STJ115206 100 µl
EUR 277.00
Description: This gene encodes a capillary endothelial cell protein that facilitates the lipolytic processing of triglyceride-rich lipoproteins. The encoded protein is a glycosylphosphatidylinositol-anchored protein that is a member of the lymphocyte antigen 6 (Ly6) family. This protein plays a major role in transporting lipoprotein lipase (LPL) from the subendothelial spaces to the capillary lumen. Mutations in this gene are the cause of hyperlipoproteinemia, type 1D. Alternate splicing results in multiple transcript variants.

GPIHBP1 Polyclonal Conjugated Antibody

C27968 100ul
EUR 397.00

Mouse GPIHBP1 shRNA Plasmid

20-abx976616
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPIHBP1 Antibody, HRP conjugated

1-CSB-PA811603LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPIHBP1. Recognizes GPIHBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPIHBP1 Antibody, FITC conjugated

1-CSB-PA811603LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPIHBP1. Recognizes GPIHBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPIHBP1 Antibody, Biotin conjugated

1-CSB-PA811603LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPIHBP1. Recognizes GPIHBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GPIHBP1 shRNA Plasmid

20-abx967233
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Gpihbp1 ELISA KIT

ELI-43919m 96 Tests
EUR 865.00

GPIHBP1 ELISA KIT|Human

EF009786 96 Tests
EUR 689.00

Human GPIHBP1 ELISA KIT

ELI-20434h 96 Tests
EUR 824.00

GPIHBP1 Recombinant Protein (Rat)

RP203240 100 ug Ask for price

GPIHBP1 Recombinant Protein (Human)

RP013741 100 ug Ask for price

GPIHBP1 Recombinant Protein (Human)

RP039535 100 ug Ask for price

GPIHBP1 Recombinant Protein (Mouse)

RP139328 100 ug Ask for price

Rat GPIHBP1 ELISA Kit

STJ150370 1 kit
EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HDL in Rat serum, plasma and other biological fluids

Human GPIHBP1 ELISA Kit

STJ150533 1 kit
EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HDL in human serum, plasma and other biological fluids

GPIHBP1 ORF Vector (Human) (pORF)

ORF004581 1.0 ug DNA
EUR 95.00

GPIHBP1 ORF Vector (Human) (pORF)

ORF013179 1.0 ug DNA
EUR 354.00

Gpihbp1 ORF Vector (Rat) (pORF)

ORF067748 1.0 ug DNA
EUR 506.00

Gpihbp1 ORF Vector (Mouse) (pORF)

ORF046444 1.0 ug DNA
EUR 506.00

Polyclonal GPIHBP1 Antibody - C-terminal region

AMM05186G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPIHBP1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Gpihbp1 ELISA Kit| Mouse Glycosylphosphatidylinositol-anchored

EF015079 96 Tests
EUR 689.00

Gpihbp1 sgRNA CRISPR Lentivector set (Rat)

K6635201 3 x 1.0 ug
EUR 339.00

Gpihbp1 sgRNA CRISPR Lentivector set (Mouse)

K3689201 3 x 1.0 ug
EUR 339.00

GPIHBP1 sgRNA CRISPR Lentivector set (Human)

K0887901 3 x 1.0 ug
EUR 339.00

Gpihbp1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6635202 1.0 ug DNA
EUR 154.00

Gpihbp1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6635203 1.0 ug DNA
EUR 154.00

Gpihbp1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6635204 1.0 ug DNA
EUR 154.00

Gpihbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3689202 1.0 ug DNA
EUR 154.00

Gpihbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3689203 1.0 ug DNA
EUR 154.00

Gpihbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3689204 1.0 ug DNA
EUR 154.00

GPIHBP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0887902 1.0 ug DNA
EUR 154.00

GPIHBP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0887903 1.0 ug DNA
EUR 154.00

GPIHBP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0887904 1.0 ug DNA
EUR 154.00

GPIHBP1 Protein Vector (Human) (pPB-N-His)

PV052714 500 ng
EUR 481.00

GPIHBP1 Protein Vector (Human) (pPM-C-His)

PV052716 500 ng
EUR 481.00

GPIHBP1 Protein Vector (Human) (pPB-C-His)

PV052713 500 ng
EUR 481.00

GPIHBP1 Protein Vector (Human) (pPM-C-HA)

PV052715 500 ng
EUR 481.00

GPIHBP1 Protein Vector (Human) (pPB-C-His)

PV018321 500 ng
EUR 329.00

GPIHBP1 Protein Vector (Human) (pPB-N-His)

PV018322 500 ng
EUR 329.00