Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

EUR 725
  • Should the Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

RDR-GPIHBP1-Hu-48Tests 48 Tests
EUR 589

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

RDR-GPIHBP1-Hu-96Tests 96 Tests
EUR 820

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

RD-GPIHBP1-Hu-48Tests 48 Tests
EUR 563

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

RD-GPIHBP1-Hu-96Tests 96 Tests
EUR 783

GPIHBP1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPIHBP1. Recognizes GPIHBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPIHBP1 Polyclonal Antibody

27968-100ul 100ul
EUR 252

GPIHBP1 Polyclonal Antibody

27968-50ul 50ul
EUR 187

GPIHBP1 Rabbit pAb

A13240-100ul 100 ul
EUR 308

GPIHBP1 Rabbit pAb

A13240-200ul 200 ul
EUR 459

GPIHBP1 Rabbit pAb

A13240-20ul 20 ul
EUR 183

GPIHBP1 Rabbit pAb

A13240-50ul 50 ul
EUR 223

GPIHBP1 cloning plasmid

CSB-CL811603HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgaaggcgctcggggctgtcctgcttgccctcttgctgttcgggcggccagggagagggcagacacagcaggaggaagaggaagaggacgaggaccacgggccagatgactacgacgaggaagatgaggatgaggtggaagaggaggagaccaacaggctccctggtggcaggag
  • Show more
Description: A cloning plasmid for the GPIHBP1 gene.

GPIHBP1 cloning plasmid

CSB-CL811603HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Show more
Description: A cloning plasmid for the GPIHBP1 gene.


PVT14518 2 ug
EUR 495

Anti-GPIHBP1 antibody

STJ115206 100 µl
EUR 277
Description: This gene encodes a capillary endothelial cell protein that facilitates the lipolytic processing of triglyceride-rich lipoproteins. The encoded protein is a glycosylphosphatidylinositol-anchored protein that is a member of the lymphocyte antigen 6 (Ly6) family. This protein plays a major role in transporting lipoprotein lipase (LPL) from the subendothelial spaces to the capillary lumen. Mutations in this gene are the cause of hyperlipoproteinemia, type 1D. Alternate splicing results in multiple transcript variants.

GPIHBP1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPIHBP1. Recognizes GPIHBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPIHBP1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPIHBP1. Recognizes GPIHBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPIHBP1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPIHBP1. Recognizes GPIHBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


ELI-20434h 96 Tests
EUR 824


EF009786 96 Tests
EUR 689

Mouse Gpihbp1 ELISA KIT

ELI-43919m 96 Tests
EUR 865

Mouse GPIHBP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPIHBP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPIHBP1 Polyclonal Conjugated Antibody

C27968 100ul
EUR 397

GPIHBP1 Recombinant Protein (Human)

RP013741 100 ug Ask for price

GPIHBP1 Recombinant Protein (Human)

RP039535 100 ug Ask for price

GPIHBP1 Recombinant Protein (Rat)

RP203240 100 ug Ask for price

GPIHBP1 Recombinant Protein (Mouse)

RP139328 100 ug Ask for price


STJ150370 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HDL in Rat serum, plasma and other biological fluids


STJ150533 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HDL in human serum, plasma and other biological fluids

Gpihbp1 ORF Vector (Rat) (pORF)

ORF067748 1.0 ug DNA
EUR 506

GPIHBP1 ORF Vector (Human) (pORF)

ORF004581 1.0 ug DNA
EUR 95

GPIHBP1 ORF Vector (Human) (pORF)

ORF013179 1.0 ug DNA
EUR 354

Gpihbp1 ORF Vector (Mouse) (pORF)

ORF046444 1.0 ug DNA
EUR 506

GPIHBP1 ELISA Kit (Mouse) (OKCA01678)

OKCA01678 96 Wells
EUR 846
Description: Description of target: Plays a key role in the lipolytic processing of chylomicrons. Required for the transport of lipoprotein lipase LPL into the capillary lumen and across endothelial cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

GPIHBP1 ELISA Kit (Human) (OKCD09371)

OKCD09371 96 Wells
EUR 909
Description: Description of target: Dietary fats are packaged by intestine into triglyceride-rich lipoproteins called chylomicrons. The triglycerides in chylomicrons are hydrolyzed by lipoprotein lipase (LPL: MIM 609708) along the luminal surface of capillaries, mainly in heart, skeletal muscle, and adipose tissue. GPIHBP1 is a capillary endothelial cell protein that provides a platform for LPL-mediated processing of chylomicrons.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.242ng/mL

GPIHBP1 ELISA Kit (Human) (OKDD00290)

OKDD00290 96 Wells
EUR 1053
Description: Description of target: This gene encodes a capillary endothelial cell protein that facilitates the lipolytic processing of triglyceride-rich lipoproteins. The encoded protein is a glycosylphosphatidylinositol-anchored protein that is a member of the lymphocyte antigen 6 (Ly6) family. This protein plays a major role in transporting lipoprotein lipase (LPL) from the subendothelial spaces to the capillary lumen. Mutations in this gene are the cause of hyperlipoproteinemia, type 1D. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.054 ng/mL

Gpihbp1 ELISA Kit| Mouse Glycosylphosphatidylinositol-anchored

EF015079 96 Tests
EUR 689

Polyclonal GPIHBP1 Antibody - C-terminal region

AMM05186G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPIHBP1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Gpihbp1 sgRNA CRISPR Lentivector set (Rat)

K6635201 3 x 1.0 ug
EUR 339

Gpihbp1 sgRNA CRISPR Lentivector set (Mouse)

K3689201 3 x 1.0 ug
EUR 339

GPIHBP1 sgRNA CRISPR Lentivector set (Human)

K0887901 3 x 1.0 ug
EUR 339

Gpihbp1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6635202 1.0 ug DNA
EUR 154

Gpihbp1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6635203 1.0 ug DNA
EUR 154

Gpihbp1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6635204 1.0 ug DNA
EUR 154

Gpihbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3689202 1.0 ug DNA
EUR 154

Gpihbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3689203 1.0 ug DNA
EUR 154

Gpihbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3689204 1.0 ug DNA
EUR 154

GPIHBP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0887902 1.0 ug DNA
EUR 154

GPIHBP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0887903 1.0 ug DNA
EUR 154

GPIHBP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0887904 1.0 ug DNA
EUR 154

GPIHBP1 Protein Vector (Rat) (pPB-C-His)

PV270990 500 ng
EUR 603

GPIHBP1 Protein Vector (Rat) (pPB-N-His)

PV270991 500 ng
EUR 603

GPIHBP1 Protein Vector (Rat) (pPM-C-HA)

PV270992 500 ng
EUR 603

GPIHBP1 Protein Vector (Rat) (pPM-C-His)

PV270993 500 ng
EUR 603

GPIHBP1 Protein Vector (Mouse) (pPB-C-His)

PV185774 500 ng
EUR 603

GPIHBP1 Protein Vector (Mouse) (pPB-N-His)

PV185775 500 ng
EUR 603