HNRNPK

HNRNPK siRNA
20-abx919685	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HNRNPK siRNA
20-abx919686	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

hnRNPK antibody
70R-49857	Fitzgerald	100 ul	EUR 287
Description: Purified Polyclonal hnRNPK antibody

HNRNPK Antibody
ABD6563	Lifescience Market	100 ug	EUR 438

HNRNPK Antibody
32393-100ul	SAB	100ul	EUR 252

HNRNPK antibody
70R-17778	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HNRNPK antibody

HNRNPK Antibody
DF6563	Affbiotech	200ul	EUR 304
Description: HNRNPK Antibody detects endogenous levels of total HNRNPK.

HNRNPK Antibody
1-CSB-PA002949	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HNRNPK. Recognizes HNRNPK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

HNRNPK Antibody
1-CSB-PA010611GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HNRNPK. Recognizes HNRNPK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HNRNPK Conjugated Antibody
C32393	SAB	100ul	EUR 397

HNRNPK cloning plasmid
CSB-CL010611HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1392 Sequence: atggaaactgaacagccagaagaaaccttccctaacactgaaaccaatggtgaatttggtaaacgccctgcagaagatatggaagaggaacaagcatttaaaagatctagaaacactgatgagatggttgaattacgcattctgcttcagagcaagaatgctggggcagtgattg Show more
Description: A cloning plasmid for the HNRNPK gene.

HNRNPK cloning plasmid
CSB-CL010611HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1395 Sequence: atggaaactgaacagccagaagaaaccttccctaacactgaaaccaatggtgaatttggtaaacgccctgcagaagatatggaagaggaacaagcatttaaaagatctagaaacactgatgagatggttgaattacgcattctgcttcagagcaagaatgctggggcagtgattg Show more
Description: A cloning plasmid for the HNRNPK gene.

anti- HNRNPK antibody
FNab03955	FN Test	100µg	EUR 505.25
Immunogen: heterogeneous nuclear ribonucleoprotein K Uniprot ID: P61978 Gene ID: 3190 Research Area: Neuroscience, Signal Transduction, Metabolism, Epigenetics
Description: Antibody raised against HNRNPK

HNRNPK Rabbit pAb
A1701-100ul	Abclonal	100 ul	EUR 308

HNRNPK Rabbit pAb
A1701-200ul	Abclonal	200 ul	EUR 459

HNRNPK Rabbit pAb
A1701-20ul	Abclonal	20 ul	EUR 183

HNRNPK Rabbit pAb
A1701-50ul	Abclonal	50 ul	EUR 223

Human HNRNPK Antibody
32784-05111	AssayPro	150 ug	EUR 261

HNRNPK Blocking Peptide
DF6563-BP	Affbiotech	1mg	EUR 195

Anti-HNRNPK antibody
PAab03955	Lifescience Market	100 ug	EUR 355

Anti-HNRNPK antibody
STJ24065	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene is located in the nucleoplasm and has three repeats of KH domains that binds to RNAs. It is distinct among other hnRNP proteins in its binding preference; it binds tenaciously to poly(C). This protein is also thought to have a role during cell cycle progession. Several alternatively spliced transcript variants have been described for this gene, however, not all of them are fully characterized.

Rat HNRNPK shRNA Plasmid
20-abx987449	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human HNRNPK ELISA Kit
ELA-E0351h	Lifescience Market	96 Tests	EUR 824

HNRNPK ELISA KIT|Human
EF000585	Lifescience Market	96 Tests	EUR 689

HNRNPK protein (His tag)
80R-2895	Fitzgerald	100 ug	EUR 349
Description: Purified recombinant HNRNPK protein (His tag)

Mouse HNRNPK shRNA Plasmid
20-abx970843	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human HNRNPK shRNA Plasmid
20-abx952180	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Phospho-HNRNPK (S284) Antibody
1-CSB-PA009241	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-HNRNPK (S284). Recognizes Phospho-HNRNPK (S284) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Phospho-HNRNPK (S216) Antibody
1-CSB-PA009242	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-HNRNPK (S216). Recognizes Phospho-HNRNPK (S216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Phospho-HNRNPK (Ser216) Antibody
CSB-PA049174-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-HNRNPK (Ser216). Recognizes Phospho-HNRNPK (Ser216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-HNRNPK (Ser216) Antibody
CSB-PA049174-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-HNRNPK (Ser216). Recognizes Phospho-HNRNPK (Ser216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HNRNPK Recombinant Protein (Human)
RP063195	ABM	100 ug	Ask for price

HNRNPK Recombinant Protein (Rat)
RP204851	ABM	100 ug	Ask for price

HNRNPK Recombinant Protein (Mouse)
RP142052	ABM	100 ug	Ask for price

Human HNRNPK Antibody (Biotin Conjugate)
32784-05121	AssayPro	150 ug	EUR 369

Hnrnpk ORF Vector (Rat) (pORF)
ORF068285	ABM	1.0 ug DNA	EUR 506

Hnrnpk ORF Vector (Mouse) (pORF)
ORF047352	ABM	1.0 ug DNA	EUR 506

HNRNPK ORF Vector (Human) (pORF)
ORF021066	ABM	1.0 ug DNA	Ask for price

HNRNPK ELISA Kit (Human) (OKCD08745)
OKCD08745	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene is located in the nucleoplasm and has three repeats of KH domains that binds to RNAs. It is distinct among other hnRNP proteins in its binding preference; it binds tenaciously to poly(C). This protein is also thought to have a role during cell cycle progession. Several alternatively spliced transcript variants have been described for this gene, however, not all of them are fully characterized.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.122ng/mL

HNRNPK ELISA Kit (Mouse) (OKEH03096)
OKEH03096	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: One of the major pre-mRNA-binding proteins. Binds tenaciously to poly(C) sequences. Likely to play a role in the nuclear metabolism of hnRNAs, particularly for pre-mRNAs that contain cytidine-rich sequences. Can also bind poly(C) single-stranded DNA. Plays an important role in p53/TP53 response to DNA damage, acting at the level of both transcription activation and repression. When sumoylated, acts as a transcriptional coactivator of p53/TP53, playing a role in p21/CDKN1A and 14-3-3 sigma/SFN induction. As far as transcription repression is concerned, acts by interacting with long intergenic RNA p21 (lincRNA-p21), a non-coding RNA induced by p53/TP53. This interaction is necessary for the induction of apoptosis, but not cell cycle arrest.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40 pg/mL

Heterogeneous Nuclear Ribonucleoprotein K (HNRNPK) Antibody
20-abx112994	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Heterogeneous Nuclear Ribonucleoprotein K (HNRNPK) Antibody
20-abx001426	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Heterogeneous Nuclear Ribonucleoprotein K (HNRNPK) Antibody
abx145983-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Heterogeneous Nuclear Ribonucleoprotein K (HNRNPK) Antibody
20-abx328729	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Heterogeneous Nuclear Ribonucleoprotein K (HNRNPK) Antibody
abx233955-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Human HNRNPK AssayLite Antibody (FITC Conjugate)
32784-05141	AssayPro	150 ug	EUR 428

Human HNRNPK AssayLite Antibody (RPE Conjugate)
32784-05151	AssayPro	150 ug	EUR 428

Human HNRNPK AssayLite Antibody (APC Conjugate)
32784-05161	AssayPro	150 ug	EUR 428

Human HNRNPK AssayLite Antibody (PerCP Conjugate)
32784-05171	AssayPro	150 ug	EUR 471

Hnrnpk sgRNA CRISPR Lentivector set (Mouse)
K4799101	ABM	3 x 1.0 ug	EUR 339

Human Heterogeneous nuclear ribonucleoprotein K (HNRNPK)
1-CSB-RP025344h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 77.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Heterogeneous nuclear ribonucleoprotein K(HNRNPK),partial expressed in E.coli

HNRNPK sgRNA CRISPR Lentivector set (Human)
K0978101	ABM	3 x 1.0 ug	EUR 339

Hnrnpk sgRNA CRISPR Lentivector set (Rat)
K7096001	ABM	3 x 1.0 ug	EUR 339

Hnrnpk sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4799102	ABM	1.0 ug DNA	EUR 154

Hnrnpk sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4799103	ABM	1.0 ug DNA	EUR 154

Hnrnpk sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4799104	ABM	1.0 ug DNA	EUR 154

HNRNPK sgRNA CRISPR Lentivector (Human) (Target 1)
K0978102	ABM	1.0 ug DNA	EUR 154

HNRNPK sgRNA CRISPR Lentivector (Human) (Target 2)
K0978103	ABM	1.0 ug DNA	EUR 154

HNRNPK sgRNA CRISPR Lentivector (Human) (Target 3)
K0978104	ABM	1.0 ug DNA	EUR 154

Hnrnpk sgRNA CRISPR Lentivector (Rat) (Target 1)
K7096002	ABM	1.0 ug DNA	EUR 154