HNRNPK

HNRNPK Antibody

1-CSB-PA010611GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HNRNPK. Recognizes HNRNPK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HNRNPK Antibody

32393-100ul 100ul
EUR 252.00

hnRNPK antibody

70R-49857 100 ul
EUR 287.00
Description: Purified Polyclonal hnRNPK antibody

HNRNPK siRNA

20-abx902504
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HNRNPK siRNA

20-abx919685
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HNRNPK siRNA

20-abx919686
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HNRNPK Antibody

DF6563 200ul
EUR 304.00
Description: HNRNPK Antibody detects endogenous levels of total HNRNPK.

HNRNPK Antibody

ABD6563 100 ug
EUR 438.00

HNRNPK antibody

70R-17778 50 ul
EUR 435.00
Description: Rabbit polyclonal HNRNPK antibody

HNRNPK Conjugated Antibody

C32393 100ul
EUR 397.00

HNRNPK cloning plasmid

CSB-CL010611HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1392
  • Sequence: atggaaactgaacagccagaagaaaccttccctaacactgaaaccaatggtgaatttggtaaacgccctgcagaagatatggaagaggaacaagcatttaaaagatctagaaacactgatgagatggttgaattacgcattctgcttcagagcaagaatgctggggcagtgattg
  • Show more
Description: A cloning plasmid for the HNRNPK gene.

HNRNPK cloning plasmid

CSB-CL010611HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1395
  • Sequence: atggaaactgaacagccagaagaaaccttccctaacactgaaaccaatggtgaatttggtaaacgccctgcagaagatatggaagaggaacaagcatttaaaagatctagaaacactgatgagatggttgaattacgcattctgcttcagagcaagaatgctggggcagtgattg
  • Show more
Description: A cloning plasmid for the HNRNPK gene.

Human HNRNPK Antibody

32784-05111 150 ug
EUR 261.00

HNRNPK Blocking Peptide

DF6563-BP 1mg
EUR 195.00

HNRNPK Rabbit pAb

A1701-100ul 100 ul
EUR 308.00

HNRNPK Rabbit pAb

A1701-200ul 200 ul
EUR 459.00

HNRNPK Rabbit pAb

A1701-20ul 20 ul
EUR 183.00

HNRNPK Rabbit pAb

A1701-50ul 50 ul
EUR 223.00

anti- HNRNPK antibody

FNab03955 100µg
EUR 505.25
  • Immunogen: heterogeneous nuclear ribonucleoprotein K
  • Uniprot ID: P61978
  • Gene ID: 3190
  • Research Area: Neuroscience, Signal Transduction, Metabolism, Epigenetics
Description: Antibody raised against HNRNPK

Anti-HNRNPK antibody

PAab03955 100 ug
EUR 355.00

Anti-HNRNPK antibody

STJ24065 100 µl
EUR 277.00
Description: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene is located in the nucleoplasm and has three repeats of KH domains that binds to RNAs. It is distinct among other hnRNP proteins in its binding preference; it binds tenaciously to poly(C). This protein is also thought to have a role during cell cycle progession. Several alternatively spliced transcript variants have been described for this gene, however, not all of them are fully characterized.

Rat HNRNPK shRNA Plasmid

20-abx987449
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-HNRNPK (S284) Antibody

1-CSB-PA009241
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-HNRNPK (S284). Recognizes Phospho-HNRNPK (S284) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Phospho-HNRNPK (S216) Antibody

1-CSB-PA009242
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-HNRNPK (S216). Recognizes Phospho-HNRNPK (S216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Phospho-HNRNPK (Ser216) Antibody

CSB-PA049174-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-HNRNPK (Ser216). Recognizes Phospho-HNRNPK (Ser216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-HNRNPK (Ser216) Antibody

CSB-PA049174-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-HNRNPK (Ser216). Recognizes Phospho-HNRNPK (Ser216) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Mouse HNRNPK shRNA Plasmid

20-abx970843
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HNRNPK shRNA Plasmid

20-abx952180
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HNRNPK protein (His tag)

80R-2895 100 ug
EUR 349.00
Description: Purified recombinant HNRNPK protein (His tag)

Human HNRNPK ELISA Kit

ELA-E0351h 96 Tests
EUR 824.00

HNRNPK ELISA KIT|Human

EF000585 96 Tests
EUR 689.00

HNRNPK Recombinant Protein (Human)

RP063195 100 ug Ask for price

HNRNPK Recombinant Protein (Rat)

RP204851 100 ug Ask for price

HNRNPK Recombinant Protein (Mouse)

RP142052 100 ug Ask for price

Human HNRNPK Antibody (Biotin Conjugate)

32784-05121 150 ug
EUR 369.00

HNRNPK ORF Vector (Human) (pORF)

ORF021066 1.0 ug DNA Ask for price

Hnrnpk ORF Vector (Mouse) (pORF)

ORF047352 1.0 ug DNA
EUR 506.00

Hnrnpk ORF Vector (Rat) (pORF)

ORF068285 1.0 ug DNA
EUR 506.00

Heterogeneous Nuclear Ribonucleoprotein K (HNRNPK) Antibody

abx145983-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Heterogeneous Nuclear Ribonucleoprotein K (HNRNPK) Antibody

20-abx112994
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human HNRNPK AssayLite Antibody (FITC Conjugate)

32784-05141 150 ug
EUR 428.00

Human HNRNPK AssayLite Antibody (RPE Conjugate)

32784-05151 150 ug
EUR 428.00

Human HNRNPK AssayLite Antibody (APC Conjugate)

32784-05161 150 ug
EUR 428.00

Human HNRNPK AssayLite Antibody (PerCP Conjugate)

32784-05171 150 ug
EUR 471.00

Heterogeneous Nuclear Ribonucleoprotein K (HNRNPK) Antibody

20-abx001426
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Heterogeneous Nuclear Ribonucleoprotein K (HNRNPK) Antibody

20-abx328729
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Heterogeneous Nuclear Ribonucleoprotein K (HNRNPK) Antibody

abx233955-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Human Heterogeneous nuclear ribonucleoprotein K (HNRNPK)

1-CSB-RP025344h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 77.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Heterogeneous nuclear ribonucleoprotein K(HNRNPK),partial expressed in E.coli

HNRNPK sgRNA CRISPR Lentivector set (Human)

K0978101 3 x 1.0 ug
EUR 339.00

Hnrnpk sgRNA CRISPR Lentivector set (Rat)

K7096001 3 x 1.0 ug
EUR 339.00

Hnrnpk sgRNA CRISPR Lentivector set (Mouse)

K4799101 3 x 1.0 ug
EUR 339.00

HNRNPK sgRNA CRISPR Lentivector (Human) (Target 1)

K0978102 1.0 ug DNA
EUR 154.00

HNRNPK sgRNA CRISPR Lentivector (Human) (Target 2)

K0978103 1.0 ug DNA
EUR 154.00

HNRNPK sgRNA CRISPR Lentivector (Human) (Target 3)

K0978104 1.0 ug DNA
EUR 154.00

Hnrnpk sgRNA CRISPR Lentivector (Rat) (Target 1)

K7096002 1.0 ug DNA
EUR 154.00

Hnrnpk sgRNA CRISPR Lentivector (Rat) (Target 2)

K7096003 1.0 ug DNA
EUR 154.00

Hnrnpk sgRNA CRISPR Lentivector (Rat) (Target 3)

K7096004 1.0 ug DNA
EUR 154.00

Hnrnpk sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4799102 1.0 ug DNA
EUR 154.00

Hnrnpk sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4799103 1.0 ug DNA
EUR 154.00

Hnrnpk sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4799104 1.0 ug DNA
EUR 154.00