IGFBP5

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DL-IGFBP5-b-48 1 kit of 48 tests
EUR 502.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5)

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DL-IGFBP5-b-96 1 kit of 96 tests
EUR 674.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5)

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DL-IGFBP5-Hu-192 1 kit of 192 tests
EUR 1011.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5)

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DL-IGFBP5-Hu-48 1 kit of 48 tests
EUR 433.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5)

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DL-IGFBP5-Hu-96 1 kit of 96 tests
EUR 575.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5)

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DL-IGFBP5-Ra-192 1 kit of 192 tests
EUR 1096.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5)

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DL-IGFBP5-Ra-48 1 kit of 48 tests
EUR 462.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5)

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DL-IGFBP5-Ra-96 1 kit of 96 tests
EUR 618.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5)

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DLR-IGFBP5-b-48T 48T
EUR 538.00
  • Should the Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DLR-IGFBP5-b-96T 96T
EUR 703.00
  • Should the Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DLR-IGFBP5-Hu-48T 48T
EUR 463.00
  • Should the Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DLR-IGFBP5-Hu-96T 96T
EUR 599.00
  • Should the Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DLR-IGFBP5-Ra-48T 48T
EUR 495.00
  • Should the Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) in samples from serum, plasma or other biological fluids.

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

DLR-IGFBP5-Ra-96T 96T
EUR 644.00
  • Should the Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) in samples from serum, plasma or other biological fluids.

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

RDR-IGFBP5-b-48Tests 48 Tests
EUR 570.00

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

RDR-IGFBP5-b-96Tests 96 Tests
EUR 793.00

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

RDR-IGFBP5-Hu-48Tests 48 Tests
EUR 481.00

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

RDR-IGFBP5-Hu-96Tests 96 Tests
EUR 665.00

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

RDR-IGFBP5-Ra-48Tests 48 Tests
EUR 519.00

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

RDR-IGFBP5-Ra-96Tests 96 Tests
EUR 720.00

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

RD-IGFBP5-b-48Tests 48 Tests
EUR 545.00

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

RD-IGFBP5-b-96Tests 96 Tests
EUR 757.00

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

RD-IGFBP5-Hu-48Tests 48 Tests
EUR 460.00

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

RD-IGFBP5-Hu-96Tests 96 Tests
EUR 636.00

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

RD-IGFBP5-Ra-48Tests 48 Tests
EUR 496.00

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit

RD-IGFBP5-Ra-96Tests 96 Tests
EUR 688.00

Igfbp5/ Rat Igfbp5 ELISA Kit

ELI-04704r 96 Tests
EUR 886.00

IGFBP5 Antibody

CSB-PA011099KA01HU-
EUR 335.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IGFBP5. Recognizes IGFBP5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

IGFBP5 Antibody

CSB-PA011099KA01HU-100ul 100ul
EUR 389.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IGFBP5. Recognizes IGFBP5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

IGFBP5 Antibody

1-CSB-PA372865
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IGFBP5. Recognizes IGFBP5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

IGFBP5 Antibody

32403-100ul 100ul
EUR 252.00

IGFBP5 protein

30R-2688 25 ug
EUR 302.00
Description: Purified recombinant Human IGFBP5 protein

IGFBP5 Antibody

DF6574 200ul
EUR 304.00
Description: IGFBP5 Antibody detects endogenous levels of total IGFBP5.

IGFBP5 Antibody

ABD6574 100 ug
EUR 438.00

IGFBP5 Antibody

7020-30T
EUR 146.00

IGFBP5 Antibody

7020-100
EUR 338.00

IGFBP5 antibody

70R-12424 100 ug
EUR 403.00
Description: Rabbit polyclonal IGFBP5 antibody

pENTR223-IGFBP5

PVT12705 2 ug
EUR 391.00

Polyclonal IGFBP5 Antibody

APR00430G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGFBP5 . This antibody is tested and proven to work in the following applications:

IGFBP5 cloning plasmid

CSB-CL011099HU-10ug 10ug
EUR 339.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atggtgttgctcaccgcggtcctcctgctgctggccgcctatgcggggccggcccagagcctgggctccttcgtgcactgcgagccctgcgacgagaaagccctctccatgtgcccccccagccccctgggctgcgagctggtcaaggagccgggctgcggctgctgcatgacctg
  • Show more
Description: A cloning plasmid for the IGFBP5 gene.

IGFBP5 Blocking Peptide

DF6574-BP 1mg
EUR 195.00

IGFBP5 Rabbit pAb

A13858-100ul 100 ul
EUR 308.00

IGFBP5 Rabbit pAb

A13858-200ul 200 ul
EUR 459.00

IGFBP5 Rabbit pAb

A13858-20ul 20 ul
EUR 183.00

IGFBP5 Rabbit pAb

A13858-50ul 50 ul
EUR 223.00

IGFBP5 Rabbit pAb

A1720-100ul 100 ul
EUR 308.00

IGFBP5 Rabbit pAb

A1720-200ul 200 ul
EUR 459.00

IGFBP5 Rabbit pAb

A1720-20ul 20 ul
EUR 183.00

IGFBP5 Rabbit pAb

A1720-50ul 50 ul
EUR 223.00

IGFBP5 Rabbit pAb

A12451-100ul 100 ul
EUR 308.00

IGFBP5 Rabbit pAb

A12451-200ul 200 ul
EUR 459.00

IGFBP5 Rabbit pAb

A12451-20ul 20 ul
EUR 183.00

IGFBP5 Rabbit pAb

A12451-50ul 50 ul
EUR 223.00

Anti-IGFBP5 Antibody

A01952-1 100ug/vial
EUR 294.00

anti- IGFBP5 antibody

FNab04180 100µg
EUR 585.00
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: insulin-like growth factor binding protein 5
  • Uniprot ID: P24593
  • Gene ID: 3488
  • Research Area: Signal Transduction
Description: Antibody raised against IGFBP5

Anti-IGFBP5 Antibody

PB9711 100ug/vial
EUR 294.00

Anti-IGFBP5 antibody

PAab04180 100 ug
EUR 412.00

pmirGLO-IGFBP5 3

PVTB00867-2a 2 ug
EUR 356.00

pmirGLO-IGFBP5 3

PVTB00867-2c 2 ug
EUR 356.00

Anti-IGFBP5 antibody

STJ115797 100 µl
EUR 277.00