Gentaur Cz

Lékařská biotechnologická výzkumná laboratoř

IGFBP5

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
DLR-IGFBP5-b-96T 96T
EUR 703
  • Should the Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
DLR-IGFBP5-Hu-48T 48T
EUR 463
  • Should the Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
DLR-IGFBP5-Hu-96T 96T
EUR 599
  • Should the Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
DLR-IGFBP5-Ra-48T 48T
EUR 495
  • Should the Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) in samples from serum, plasma or other biological fluids.

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
DLR-IGFBP5-Ra-96T 96T
EUR 644
  • Should the Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) in samples from serum, plasma or other biological fluids.

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
RD-IGFBP5-b-48Tests 48 Tests
EUR 545

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
RD-IGFBP5-b-96Tests 96 Tests
EUR 757

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
RD-IGFBP5-Hu-48Tests 48 Tests
EUR 460

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
RD-IGFBP5-Hu-96Tests 96 Tests
EUR 636

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
RD-IGFBP5-Ra-48Tests 48 Tests
EUR 496

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
RD-IGFBP5-Ra-96Tests 96 Tests
EUR 688

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
RDR-IGFBP5-b-48Tests 48 Tests
EUR 570

Bovine Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
RDR-IGFBP5-b-96Tests 96 Tests
EUR 793

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
RDR-IGFBP5-Hu-48Tests 48 Tests
EUR 481

Human Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
RDR-IGFBP5-Hu-96Tests 96 Tests
EUR 665

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
RDR-IGFBP5-Ra-48Tests 48 Tests
EUR 519

Rat Insulin Like Growth Factor Binding Protein 5 (IGFBP5) ELISA Kit
RDR-IGFBP5-Ra-96Tests 96 Tests
EUR 720

Igfbp5/ Rat Igfbp5 ELISA Kit
ELI-04704r 96 Tests
EUR 886

IGFBP5 Antibody
ABD6574 100 ug
EUR 438

IGFBP5 protein
30R-2688 25 ug
EUR 302
Description: Purified recombinant Human IGFBP5 protein

IGFBP5 Antibody
32403-100ul 100ul
EUR 252

IGFBP5 antibody
70R-12424 100 ug
EUR 403
Description: Rabbit polyclonal IGFBP5 antibody

IGFBP5 Antibody
7020-100
EUR 338

IGFBP5 Antibody
7020-30T
EUR 146

IGFBP5 Antibody
DF6574 200ul
EUR 304
Description: IGFBP5 Antibody detects endogenous levels of total IGFBP5.

IGFBP5 Antibody
CSB-PA011099KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IGFBP5. Recognizes IGFBP5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

IGFBP5 Antibody
CSB-PA011099KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IGFBP5. Recognizes IGFBP5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

IGFBP5 Antibody
1-CSB-PA372865
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IGFBP5. Recognizes IGFBP5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

pENTR223-IGFBP5
PVT12705 2 ug
EUR 391

Polyclonal IGFBP5 Antibody
APR00430G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGFBP5 . This antibody is tested and proven to work in the following applications:

IGFBP5 cloning plasmid
CSB-CL011099HU-10ug 10ug
EUR 339
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atggtgttgctcaccgcggtcctcctgctgctggccgcctatgcggggccggcccagagcctgggctccttcgtgcactgcgagccctgcgacgagaaagccctctccatgtgcccccccagccccctgggctgcgagctggtcaaggagccgggctgcggctgctgcatgacctg
  • Show more
Description: A cloning plasmid for the IGFBP5 gene.

anti- IGFBP5 antibody
FNab04180 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: insulin-like growth factor binding protein 5
  • Uniprot ID: P24593
  • Gene ID: 3488
  • Research Area: Signal Transduction
Description: Antibody raised against IGFBP5

Anti-IGFBP5 Antibody
A01952-1 100ug/vial
EUR 294

IGFBP5 Rabbit pAb
A12451-100ul 100 ul
EUR 308

IGFBP5 Rabbit pAb
A12451-200ul 200 ul
EUR 459

IGFBP5 Rabbit pAb
A12451-20ul 20 ul
EUR 183

IGFBP5 Rabbit pAb
A12451-50ul 50 ul
EUR 223

IGFBP5 Rabbit pAb
A13858-100ul 100 ul
EUR 308

IGFBP5 Rabbit pAb
A13858-200ul 200 ul
EUR 459

IGFBP5 Rabbit pAb
A13858-20ul 20 ul
EUR 183

IGFBP5 Rabbit pAb
A13858-50ul 50 ul
EUR 223

IGFBP5 Rabbit pAb
A1720-100ul 100 ul
EUR 308

IGFBP5 Rabbit pAb
A1720-200ul 200 ul
EUR 459

IGFBP5 Rabbit pAb
A1720-20ul 20 ul
EUR 183

IGFBP5 Rabbit pAb
A1720-50ul 50 ul
EUR 223

IGFBP5 Blocking Peptide
DF6574-BP 1mg
EUR 195

Anti-IGFBP5 Antibody
PB9711 100ug/vial
EUR 294

Anti-IGFBP5 antibody
PAab04180 100 ug
EUR 412

pmirGLO-IGFBP5 3
PVTB00867-2a 2 ug
EUR 356

pmirGLO-IGFBP5 3
PVTB00867-2c 2 ug
EUR 356

Anti-IGFBP5 antibody
STJ114325 100 µl
EUR 277

Anti-IGFBP5 antibody
STJ119391 100 µl
EUR 277

Anti-IGFBP5 antibody
STJ115797 100 µl
EUR 277

Polyclonal IGFBP5 Antibody (Center)
APR04970G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGFBP5 (Center). This antibody is tested and proven to work in the following applications:

Rat IGFBP5 shRNA Plasmid
20-abx984895
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IGFBP5 ELISA Kit
EHI0097 96Tests
EUR 521

Human IGFBP5 ELISA Kit
ELA-E1441h 96 Tests
EUR 824

Goat IGFBP5 ELISA Kit
EGTI0097 96Tests
EUR 521

Bovine IGFBP5 ELISA Kit
EBI0097 96Tests
EUR 521

Canine IGFBP5 ELISA Kit
ECI0097 96Tests
EUR 521