
Human Interleukin 33 (IL33) ELISA Kit

DLR-IL33-Hu-96T 96T
EUR 573
  • Should the Human Interleukin 33 (IL33) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 33 (IL33) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Interleukin 33 (IL33) ELISA Kit

DLR-IL33-Mu-48T 48T
EUR 454
  • Should the Mouse Interleukin 33 (IL33) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interleukin 33 (IL33) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Interleukin 33 (IL33) ELISA Kit

DLR-IL33-Mu-96T 96T
EUR 587
  • Should the Mouse Interleukin 33 (IL33) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interleukin 33 (IL33) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Interleukin 33 (IL33) ELISA Kit

DLR-IL33-Ra-48T 48T
EUR 475
  • Should the Rat Interleukin 33 (IL33) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 33 (IL33) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Interleukin 33 (IL33) ELISA Kit

DLR-IL33-Ra-96T 96T
EUR 616
  • Should the Rat Interleukin 33 (IL33) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 33 (IL33) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Interleukin 33 (IL33) ELISA Kit

RD-IL33-Hu-48Tests 48 Tests
EUR 439

Human Interleukin 33 (IL33) ELISA Kit

RD-IL33-Hu-96Tests 96 Tests
EUR 606

Mouse Interleukin 33 (IL33) ELISA Kit

RD-IL33-Mu-48Tests 48 Tests
EUR 450

Mouse Interleukin 33 (IL33) ELISA Kit

RD-IL33-Mu-96Tests 96 Tests
EUR 622

Rat Interleukin 33 (IL33) ELISA Kit

RD-IL33-Ra-48Tests 48 Tests
EUR 473

Rat Interleukin 33 (IL33) ELISA Kit

RD-IL33-Ra-96Tests 96 Tests
EUR 655

Human Interleukin 33 (IL33) ELISA Kit

RDR-IL33-Hu-48Tests 48 Tests
EUR 458

Human Interleukin 33 (IL33) ELISA Kit

RDR-IL33-Hu-96Tests 96 Tests
EUR 633

Mouse Interleukin 33 (IL33) ELISA Kit

RDR-IL33-Mu-48Tests 48 Tests
EUR 470

Mouse Interleukin 33 (IL33) ELISA Kit

RDR-IL33-Mu-96Tests 96 Tests
EUR 651

Rat Interleukin 33 (IL33) ELISA Kit

RDR-IL33-Ra-48Tests 48 Tests
EUR 495

Rat Interleukin 33 (IL33) ELISA Kit

RDR-IL33-Ra-96Tests 96 Tests
EUR 685

Il33/ Rat Il33 ELISA Kit

ELI-06362r 96 Tests
EUR 886

IL33 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IL33 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IL33 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Il33 protein

80R-4312 100 ug
EUR 327
Description: Purified Recombinant Il33 protein (His tagged)

IL33 antibody

70R-3671 50 ug
EUR 467
Description: Rabbit polyclonal IL33 antibody raised against the N terminal of IL33

IL33 antibody

70R-IR045 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal IL33 antibody

IL33 Antibody

ABD8319 100 ug
EUR 438

IL33 Antibody

45270-100ul 100ul
EUR 252

IL33 Antibody

45270-50ul 50ul
EUR 187

IL33 antibody

10R-1085 100 ul
EUR 316
Description: Mouse monoclonal IL33 antibody

IL33 protein

30R-1105 100 ug
EUR 586
Description: Purified recombinant Human IL33 protein

IL33 protein

30R-2528 10 ug
EUR 359
Description: Purified recombinant Human IL33 protein

IL33 protein

30R-2529 10 ug
EUR 302
Description: Purified recombinant Mouse IL33 protein

IL33 protein

30R-AI118 10 ug
EUR 273
Description: Purified recombinant Human IL33 protein

IL33 antibody

70R-17952 50 ul
EUR 435
Description: Rabbit polyclonal IL33 antibody

IL33 Antibody

DF8319 200ul
EUR 304
Description: IL33 Antibody detects endogenous levels of total IL33.

IL33 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IL33. Recognizes IL33 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

IL33 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IL33. Recognizes IL33 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

IL33 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IL33. Recognizes IL33 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


YF-PA21674 50 ul
EUR 363
Description: Mouse polyclonal to IL33

IL33 Conjugated Antibody

C45270 100ul
EUR 397

IL33 cloning plasmid

CSB-CL011656HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 813
  • Sequence: atgaagcctaaaatgaagtattcaaccaacaaaatttccacagcaaagtggaagaacacagcaagcaaagccttgtgtttcaagctgggaaaatcccaacagaaggccaaagaagtttgccccatgtactttatgaagctccgctctggccttatgataaaaaaggaggcctgtta
  • Show more
Description: A cloning plasmid for the IL33 gene.

anti- IL33 antibody

FNab04271 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: interleukin 33
  • Uniprot ID: O95760
  • Gene ID: 90865
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against IL33

anti- IL33 antibody

FNab04272 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • Immunogen: interleukin 33
  • Uniprot ID: O95760
  • Gene ID: 90865
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against IL33

Anti-IL33 Antibody

A00113 100ug/vial
EUR 334

Anti-IL33 Antibody

A00113-1 100ug/vial
EUR 334

Anti-IL33 Antibody

A00113-2 100ug/vial
EUR 334

IL33 Rabbit pAb

A12604-100ul 100 ul
EUR 308

IL33 Rabbit pAb

A12604-200ul 200 ul
EUR 459

IL33 Rabbit pAb

A12604-20ul 20 ul
EUR 183

IL33 Rabbit pAb

A12604-50ul 50 ul
EUR 223

IL33 Rabbit pAb

A8096-100ul 100 ul
EUR 308

IL33 Rabbit pAb

A8096-200ul 200 ul
EUR 459

IL33 Rabbit pAb

A8096-20ul 20 ul
EUR 183

IL33 Rabbit pAb

A8096-50ul 50 ul
EUR 223

IL33 Blocking Peptide

33R-1291 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HIBADH antibody, catalog no. 70R-2475

IL33 protein (Mouse)

30R-2190 25 ug
EUR 651
Description: Purified recombinant Mouse IL33 protein

IL33 protein (Mouse)

30R-2270 100 ug
EUR 1969
Description: Purified recombinant Mouse IL33 protein

IL33 protein (Mouse)

30R-AI143 10 ug
EUR 273
Description: Purified recombinant Mouse IL33 protein

Mouse IL33 Antibody

32846-05111 150 ug
EUR 261

IL33 Blocking Peptide

DF8319-BP 1mg
EUR 195

Anti-IL33 antibody

PAab04271 100 ug
EUR 412