Gentaur Cz

Lékařská biotechnologická výzkumná laboratoř

KIF13A

KIF13A siRNA
20-abx921582
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Mouse Kinesin- like protein KIF13A, Kif13a ELISA KIT
ELI-15852m 96 Tests
EUR 865

Human Kinesin- like protein KIF13A, KIF13A ELISA KIT
ELI-23742h 96 Tests
EUR 824

KIF13A Polyclonal Antibody
29471-100ul 100ul
EUR 252

KIF13A Polyclonal Antibody
29471-50ul 50ul
EUR 187

KIF13A Rabbit pAb
A15880-100ul 100 ul
EUR 308

KIF13A Rabbit pAb
A15880-200ul 200 ul
EUR 459

KIF13A Rabbit pAb
A15880-20ul 20 ul
EUR 183

KIF13A Rabbit pAb
A15880-50ul 50 ul
EUR 223

KIF13A cloning plasmid
CSB-CL880944HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5313
  • Sequence: ATGTCGGATACCAAGGTAAAAGTTGCCGTCCGGGTCCGGCCCATGAACCGACGAGAACTGGAACTGAACACCAAGTGCGTGGTGGAGATGGAAGGGAATCAAACGGTCCTGCACCCTCCTCCTTCTAACACCAAACAGGGAGAAAGGAAACCTCCCAAGGTATTTGCCTTTGATT
  • Show more
Description: A cloning plasmid for the KIF13A gene.

Anti-KIF13A antibody
STJ118339 100 µl
EUR 277

Anti-KIF13A Antibody
STJ501534 100 µg
EUR 476

KIF13A Antibody, HRP conjugated
1-CSB-PA880944LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF13A. Recognizes KIF13A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KIF13A Antibody, FITC conjugated
1-CSB-PA880944LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF13A. Recognizes KIF13A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KIF13A Antibody, Biotin conjugated
1-CSB-PA880944LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF13A. Recognizes KIF13A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

KIF13A Polyclonal Conjugated Antibody
C29471 100ul
EUR 397

Human KIF13A shRNA Plasmid
20-abx961884
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCR-BluntII-TOPO-KIF13A
PVT17485 2 ug
EUR 383

Anti-KIF13A Antibody (Biotin)
STJ501535 100 µg
EUR 586

Anti-KIF13A Antibody (FITC)
STJ501536 100 µg
EUR 586

Kif13a ORF Vector (Rat) (pORF)
ORF069037 1.0 ug DNA
EUR 2080

KIF13A ORF Vector (Human) (pORF)
ORF013463 1.0 ug DNA
EUR 354

Kif13a ORF Vector (Mouse) (pORF)
ORF048545 1.0 ug DNA
EUR 1572

Kif13a sgRNA CRISPR Lentivector set (Rat)
K6141801 3 x 1.0 ug
EUR 339

Kif13a sgRNA CRISPR Lentivector set (Mouse)
K3965001 3 x 1.0 ug
EUR 339

KIF13A sgRNA CRISPR Lentivector set (Human)
K1147501 3 x 1.0 ug
EUR 339

Kif13a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6141802 1.0 ug DNA
EUR 154

Kif13a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6141803 1.0 ug DNA
EUR 154

Kif13a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6141804 1.0 ug DNA
EUR 154

Kif13a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3965002 1.0 ug DNA
EUR 154

Kif13a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3965003 1.0 ug DNA
EUR 154

Kif13a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3965004 1.0 ug DNA
EUR 154

KIF13A sgRNA CRISPR Lentivector (Human) (Target 1)
K1147502 1.0 ug DNA
EUR 154

KIF13A sgRNA CRISPR Lentivector (Human) (Target 2)
K1147503 1.0 ug DNA
EUR 154

KIF13A sgRNA CRISPR Lentivector (Human) (Target 3)
K1147504 1.0 ug DNA
EUR 154

KIF13A Protein Vector (Rat) (pPB-C-His)
PV276146 500 ng
EUR 2826

KIF13A Protein Vector (Rat) (pPB-N-His)
PV276147 500 ng
EUR 2826

KIF13A Protein Vector (Rat) (pPM-C-HA)
PV276148 500 ng
EUR 2826

KIF13A Protein Vector (Rat) (pPM-C-His)
PV276149 500 ng
EUR 2826

KIF13A Protein Vector (Mouse) (pPB-C-His)
PV194178 500 ng
EUR 2917

KIF13A Protein Vector (Mouse) (pPB-N-His)
PV194179 500 ng
EUR 2917

KIF13A Protein Vector (Mouse) (pPM-C-HA)
PV194180 500 ng
EUR 2917

KIF13A Protein Vector (Mouse) (pPM-C-His)
PV194181 500 ng
EUR 2917

KIF13A Protein Vector (Human) (pPB-C-His)
PV053849 500 ng
EUR 481

KIF13A Protein Vector (Human) (pPB-N-His)
PV053850 500 ng
EUR 481

KIF13A Protein Vector (Human) (pPM-C-HA)
PV053851 500 ng
EUR 481

KIF13A Protein Vector (Human) (pPM-C-His)
PV053852 500 ng
EUR 481

Kif13a 3'UTR Luciferase Stable Cell Line
TU110543 1.0 ml Ask for price

Kif13a 3'UTR GFP Stable Cell Line
TU160543 1.0 ml Ask for price

Kif13a 3'UTR Luciferase Stable Cell Line
TU206678 1.0 ml Ask for price

Kif13a 3'UTR GFP Stable Cell Line
TU256678 1.0 ml Ask for price

KIF13A 3'UTR GFP Stable Cell Line
TU061768 1.0 ml
EUR 4617

KIF13A 3'UTR Luciferase Stable Cell Line
TU011768 1.0 ml
EUR 4617

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6141805 3 x 1.0 ug
EUR 376

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3965005 3 x 1.0 ug
EUR 376

KIF13A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1147505 3 x 1.0 ug
EUR 376

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6141806 1.0 ug DNA
EUR 167

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6141807 1.0 ug DNA
EUR 167

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6141808 1.0 ug DNA
EUR 167

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3965006 1.0 ug DNA
EUR 167

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3965007 1.0 ug DNA
EUR 167

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3965008 1.0 ug DNA
EUR 167

KIF13A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1147506 1.0 ug DNA
EUR 167

KIF13A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1147507 1.0 ug DNA
EUR 167

KIF13A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1147508 1.0 ug DNA
EUR 167