KIF13A

KIF13A Antibody
1-CSB-PA880944LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF13A. Recognizes KIF13A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

Human Kinesin- like protein KIF13A, KIF13A ELISA KIT
ELI-23742h	Lifescience Market	96 Tests	EUR 824

Mouse Kinesin- like protein KIF13A, Kif13a ELISA KIT
ELI-15852m	Lifescience Market	96 Tests	EUR 865

KIF13A Rabbit pAb
A15880-100ul	Abclonal	100 ul	EUR 308

KIF13A Rabbit pAb
A15880-200ul	Abclonal	200 ul	EUR 459

KIF13A Rabbit pAb
A15880-20ul	Abclonal	20 ul	EUR 183

KIF13A Rabbit pAb
A15880-50ul	Abclonal	50 ul	EUR 223

KIF13A Polyclonal Antibody
29471-100ul	SAB	100ul	EUR 252

KIF13A Polyclonal Antibody
29471-50ul	SAB	50ul	EUR 187

KIF13A cloning plasmid
CSB-CL880944HU-10ug	Cusabio	10ug	EUR 2770
Formulation: 10 μg plasmid + 200μl Glycerol Length: 5313 Sequence: ATGTCGGATACCAAGGTAAAAGTTGCCGTCCGGGTCCGGCCCATGAACCGACGAGAACTGGAACTGAACACCAAGTGCGTGGTGGAGATGGAAGGGAATCAAACGGTCCTGCACCCTCCTCCTTCTAACACCAAACAGGGAGAAAGGAAACCTCCCAAGGTATTTGCCTTTGATT Show more
Description: A cloning plasmid for the KIF13A gene.

Anti-KIF13A Antibody
STJ501534	St John's Laboratory	100 µg	EUR 476

Anti-KIF13A antibody
STJ118339	St John's Laboratory	100 µl	EUR 277

KIF13A Polyclonal Conjugated Antibody
C29471	SAB	100ul	EUR 397

Human KIF13A shRNA Plasmid
20-abx961884	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KIF13A Antibody, HRP conjugated
1-CSB-PA880944LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF13A. Recognizes KIF13A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KIF13A Antibody, FITC conjugated
1-CSB-PA880944LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF13A. Recognizes KIF13A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KIF13A Antibody, Biotin conjugated
1-CSB-PA880944LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF13A. Recognizes KIF13A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

pCR-BluntII-TOPO-KIF13A
PVT17485	Lifescience Market	2 ug	EUR 383

Anti-KIF13A Antibody (Biotin)
STJ501535	St John's Laboratory	100 µg	EUR 586

Anti-KIF13A Antibody (FITC)
STJ501536	St John's Laboratory	100 µg	EUR 586

Kif13a ORF Vector (Rat) (pORF)
ORF069037	ABM	1.0 ug DNA	EUR 2080

Kif13a ORF Vector (Mouse) (pORF)
ORF048545	ABM	1.0 ug DNA	EUR 1572

KIF13A ORF Vector (Human) (pORF)
ORF013463	ABM	1.0 ug DNA	EUR 354

KIF13A sgRNA CRISPR Lentivector set (Human)
K1147501	ABM	3 x 1.0 ug	EUR 339

Kif13a sgRNA CRISPR Lentivector set (Rat)
K6141801	ABM	3 x 1.0 ug	EUR 339

Kif13a sgRNA CRISPR Lentivector set (Mouse)
K3965001	ABM	3 x 1.0 ug	EUR 339

KIF13A sgRNA CRISPR Lentivector (Human) (Target 1)
K1147502	ABM	1.0 ug DNA	EUR 154

KIF13A sgRNA CRISPR Lentivector (Human) (Target 2)
K1147503	ABM	1.0 ug DNA	EUR 154

KIF13A sgRNA CRISPR Lentivector (Human) (Target 3)
K1147504	ABM	1.0 ug DNA	EUR 154

Kif13a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6141802	ABM	1.0 ug DNA	EUR 154

Kif13a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6141803	ABM	1.0 ug DNA	EUR 154

Kif13a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6141804	ABM	1.0 ug DNA	EUR 154

Kif13a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3965002	ABM	1.0 ug DNA	EUR 154

Kif13a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3965003	ABM	1.0 ug DNA	EUR 154

Kif13a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3965004	ABM	1.0 ug DNA	EUR 154

KIF13A Protein Vector (Human) (pPB-C-His)
PV053849	ABM	500 ng	EUR 481

KIF13A Protein Vector (Human) (pPB-N-His)
PV053850	ABM	500 ng	EUR 481

KIF13A Protein Vector (Human) (pPM-C-HA)
PV053851	ABM	500 ng	EUR 481

KIF13A Protein Vector (Human) (pPM-C-His)
PV053852	ABM	500 ng	EUR 481

KIF13A Protein Vector (Rat) (pPB-C-His)
PV276146	ABM	500 ng	EUR 2826

KIF13A Protein Vector (Rat) (pPB-N-His)
PV276147	ABM	500 ng	EUR 2826

KIF13A Protein Vector (Rat) (pPM-C-HA)
PV276148	ABM	500 ng	EUR 2826

KIF13A Protein Vector (Rat) (pPM-C-His)
PV276149	ABM	500 ng	EUR 2826

KIF13A Protein Vector (Mouse) (pPB-C-His)
PV194178	ABM	500 ng	EUR 2917

KIF13A Protein Vector (Mouse) (pPB-N-His)
PV194179	ABM	500 ng	EUR 2917

KIF13A Protein Vector (Mouse) (pPM-C-HA)
PV194180	ABM	500 ng	EUR 2917

KIF13A Protein Vector (Mouse) (pPM-C-His)
PV194181	ABM	500 ng	EUR 2917

Kif13a 3'UTR Luciferase Stable Cell Line
TU206678	ABM	1.0 ml	Ask for price

Kif13a 3'UTR GFP Stable Cell Line
TU160543	ABM	1.0 ml	Ask for price

KIF13A 3'UTR Luciferase Stable Cell Line
TU011768	ABM	1.0 ml	EUR 4617

Kif13a 3'UTR Luciferase Stable Cell Line
TU110543	ABM	1.0 ml	Ask for price

KIF13A 3'UTR GFP Stable Cell Line
TU061768	ABM	1.0 ml	EUR 4617

Kif13a 3'UTR GFP Stable Cell Line
TU256678	ABM	1.0 ml	Ask for price

KIF13A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1147505	ABM	3 x 1.0 ug	EUR 376

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6141805	ABM	3 x 1.0 ug	EUR 376

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3965005	ABM	3 x 1.0 ug	EUR 376

KIF13A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1147506	ABM	1.0 ug DNA	EUR 167

KIF13A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1147507	ABM	1.0 ug DNA	EUR 167

KIF13A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1147508	ABM	1.0 ug DNA	EUR 167

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6141806	ABM	1.0 ug DNA	EUR 167

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6141807	ABM	1.0 ug DNA	EUR 167

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6141808	ABM	1.0 ug DNA	EUR 167

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3965006	ABM	1.0 ug DNA	EUR 167

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3965007	ABM	1.0 ug DNA	EUR 167

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3965008	ABM	1.0 ug DNA	EUR 167