KIF13A

KIF13A Antibody

1-CSB-PA880944LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF13A. Recognizes KIF13A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

Human Kinesin- like protein KIF13A, KIF13A ELISA KIT

ELI-23742h 96 Tests
EUR 824.00

Mouse Kinesin- like protein KIF13A, Kif13a ELISA KIT

ELI-15852m 96 Tests
EUR 865.00

KIF13A cloning plasmid

CSB-CL880944HU-10ug 10ug
EUR 2770.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5313
  • Sequence: ATGTCGGATACCAAGGTAAAAGTTGCCGTCCGGGTCCGGCCCATGAACCGACGAGAACTGGAACTGAACACCAAGTGCGTGGTGGAGATGGAAGGGAATCAAACGGTCCTGCACCCTCCTCCTTCTAACACCAAACAGGGAGAAAGGAAACCTCCCAAGGTATTTGCCTTTGATT
  • Show more
Description: A cloning plasmid for the KIF13A gene.

KIF13A Polyclonal Antibody

29471-100ul 100ul
EUR 252.00

KIF13A Polyclonal Antibody

29471-50ul 50ul
EUR 187.00

KIF13A Rabbit pAb

A15880-100ul 100 ul
EUR 308.00

KIF13A Rabbit pAb

A15880-200ul 200 ul
EUR 459.00

KIF13A Rabbit pAb

A15880-20ul 20 ul
EUR 183.00

KIF13A Rabbit pAb

A15880-50ul 50 ul
EUR 223.00

Anti-KIF13A antibody

STJ118339 100 µl
EUR 277.00

Anti-KIF13A Antibody

STJ501534 100 µg
EUR 476.00

KIF13A Polyclonal Conjugated Antibody

C29471 100ul
EUR 397.00

Human KIF13A shRNA Plasmid

20-abx961884
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KIF13A Antibody, HRP conjugated

1-CSB-PA880944LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF13A. Recognizes KIF13A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KIF13A Antibody, FITC conjugated

1-CSB-PA880944LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF13A. Recognizes KIF13A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KIF13A Antibody, Biotin conjugated

1-CSB-PA880944LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF13A. Recognizes KIF13A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

pCR-BluntII-TOPO-KIF13A

PVT17485 2 ug
EUR 383.00

Anti-KIF13A Antibody (Biotin)

STJ501535 100 µg
EUR 586.00

Anti-KIF13A Antibody (FITC)

STJ501536 100 µg
EUR 586.00

KIF13A ORF Vector (Human) (pORF)

ORF013463 1.0 ug DNA
EUR 354.00

Kif13a ORF Vector (Rat) (pORF)

ORF069037 1.0 ug DNA
EUR 2080.00

Kif13a ORF Vector (Mouse) (pORF)

ORF048545 1.0 ug DNA
EUR 1572.00

KIF13A sgRNA CRISPR Lentivector set (Human)

K1147501 3 x 1.0 ug
EUR 339.00

Kif13a sgRNA CRISPR Lentivector set (Rat)

K6141801 3 x 1.0 ug
EUR 339.00

Kif13a sgRNA CRISPR Lentivector set (Mouse)

K3965001 3 x 1.0 ug
EUR 339.00

KIF13A sgRNA CRISPR Lentivector (Human) (Target 1)

K1147502 1.0 ug DNA
EUR 154.00

KIF13A sgRNA CRISPR Lentivector (Human) (Target 2)

K1147503 1.0 ug DNA
EUR 154.00

KIF13A sgRNA CRISPR Lentivector (Human) (Target 3)

K1147504 1.0 ug DNA
EUR 154.00

Kif13a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6141802 1.0 ug DNA
EUR 154.00

Kif13a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6141803 1.0 ug DNA
EUR 154.00

Kif13a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6141804 1.0 ug DNA
EUR 154.00

Kif13a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3965002 1.0 ug DNA
EUR 154.00

Kif13a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3965003 1.0 ug DNA
EUR 154.00

Kif13a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3965004 1.0 ug DNA
EUR 154.00

KIF13A Protein Vector (Rat) (pPB-C-His)

PV276146 500 ng
EUR 2826.00

KIF13A Protein Vector (Rat) (pPB-N-His)

PV276147 500 ng
EUR 2826.00

KIF13A Protein Vector (Rat) (pPM-C-HA)

PV276148 500 ng
EUR 2826.00

KIF13A Protein Vector (Rat) (pPM-C-His)

PV276149 500 ng
EUR 2826.00

KIF13A Protein Vector (Mouse) (pPB-C-His)

PV194178 500 ng
EUR 2917.00

KIF13A Protein Vector (Mouse) (pPB-N-His)

PV194179 500 ng
EUR 2917.00

KIF13A Protein Vector (Mouse) (pPM-C-HA)

PV194180 500 ng
EUR 2917.00

KIF13A Protein Vector (Mouse) (pPM-C-His)

PV194181 500 ng
EUR 2917.00

KIF13A Protein Vector (Human) (pPB-C-His)

PV053849 500 ng
EUR 481.00

KIF13A Protein Vector (Human) (pPB-N-His)

PV053850 500 ng
EUR 481.00

KIF13A Protein Vector (Human) (pPM-C-HA)

PV053851 500 ng
EUR 481.00

KIF13A Protein Vector (Human) (pPM-C-His)

PV053852 500 ng
EUR 481.00

Kif13a 3'UTR GFP Stable Cell Line

TU160543 1.0 ml Ask for price

Kif13a 3'UTR Luciferase Stable Cell Line

TU110543 1.0 ml Ask for price

KIF13A 3'UTR Luciferase Stable Cell Line

TU011768 1.0 ml
EUR 4617.00

Kif13a 3'UTR Luciferase Stable Cell Line

TU206678 1.0 ml Ask for price

KIF13A 3'UTR GFP Stable Cell Line

TU061768 1.0 ml
EUR 4617.00

Kif13a 3'UTR GFP Stable Cell Line

TU256678 1.0 ml Ask for price

KIF13A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1147505 3 x 1.0 ug
EUR 376.00

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6141805 3 x 1.0 ug
EUR 376.00

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3965005 3 x 1.0 ug
EUR 376.00

KIF13A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1147506 1.0 ug DNA
EUR 167.00

KIF13A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1147507 1.0 ug DNA
EUR 167.00

KIF13A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1147508 1.0 ug DNA
EUR 167.00

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6141806 1.0 ug DNA
EUR 167.00

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6141807 1.0 ug DNA
EUR 167.00

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6141808 1.0 ug DNA
EUR 167.00

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3965006 1.0 ug DNA
EUR 167.00

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3965007 1.0 ug DNA
EUR 167.00

Kif13a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3965008 1.0 ug DNA
EUR 167.00