LDHD

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
DLR-LDHD-Hu-96T	DL Develop	96T	EUR 673
Should the Human Lactate Dehydrogenase D (LDHD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lactate Dehydrogenase D (LDHD) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
RDR-LDHD-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
RDR-LDHD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
RD-LDHD-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
RD-LDHD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

LDHD antibody
70R-18240	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal LDHD antibody

LDHD Antibody
43520-100ul	SAB	100ul	EUR 252

LDHD Antibody
43877-100ul	SAB	100ul	EUR 252

LDHD Antibody
1-CSB-PA080118	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:1000-5000

LDHD Antibody
1-CSB-PA801250LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

LDHD antibody
70R-3502	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal LDHD antibody raised against the middle region of LDHD

LDHD Antibody
1-CSB-PA012845GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

LDHD siRNA
20-abx922391	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LDHD siRNA
20-abx922392	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-LDHD
YF-PA22659	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to LDHD

anti-LDHD
YF-PA22660	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to LDHD

LDHD Rabbit pAb
A15965-100ul	Abclonal	100 ul	EUR 308

LDHD Rabbit pAb
A15965-200ul	Abclonal	200 ul	EUR 459

LDHD Rabbit pAb
A15965-20ul	Abclonal	20 ul	EUR 183

LDHD Rabbit pAb
A15965-50ul	Abclonal	50 ul	EUR 223

LDHD Blocking Peptide
33R-5196	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDHD antibody, catalog no. 70R-3502

LDHD Polyclonal Antibody
EA126-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against LDHD from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

LDHD Polyclonal Antibody
EA126-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against LDHD from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

LDHD Conjugated Antibody
C43520	SAB	100ul	EUR 397

LDHD Conjugated Antibody
C43877	SAB	100ul	EUR 397

LDHD cloning plasmid
CSB-CL801250HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1524 Sequence: atggcccgactgctcaggtctgcaacctgggagctgttcccctggaggggctactgctcccagaaggcaaagggagagctctgcagggacttcgtagaggctctgaaggccgtggtgggcggctcccacgtgtccactgccgcggtggtccgagagcagcacgggcgcgatgagt Show more
Description: A cloning plasmid for the LDHD gene.

LDHD Polyclonal Antibody
A65962	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

LDHD Rabbit pAb
A5196-100ul	Abclonal	100 ul	EUR 308

LDHD Rabbit pAb
A5196-200ul	Abclonal	200 ul	EUR 459

LDHD Rabbit pAb
A5196-20ul	Abclonal	20 ul	Ask for price

LDHD Rabbit pAb
A5196-50ul	Abclonal	50 ul	Ask for price

LDHD Polyclonal Antibody
ABP57154-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of LDHD from Human, Mouse, Rat. This LDHD antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

LDHD Polyclonal Antibody
ABP57154-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of LDHD from Human, Mouse, Rat. This LDHD antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

LDHD Polyclonal Antibody
ABP57154-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of LDHD from Human, Mouse, Rat. This LDHD antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

LDHD Polyclonal Antibody
ES8153-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against LDHD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

LDHD Polyclonal Antibody
ES8153-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against LDHD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

anti- LDHD antibody
FNab04741	FN Test	100µg	EUR 548.75
Immunogen: lactate dehydrogenase D Uniprot ID: Q86WU2 Gene ID: 197257 Research Area: Metabolism
Description: Antibody raised against LDHD

Anti-LDHD antibody
PAab04741	Lifescience Market	100 ug	EUR 386

Anti-LDHD antibody
STJ111240	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family. The similar protein in yeast has both D-lactate and D-glycerate dehydrogenase activities. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.

Anti-LDHD antibody
STJ118424	St John's Laboratory	100 µl	EUR 277

Anti-LDHD antibody
STJ97199	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to LDHD.

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

LDHD Antibody, HRP conjugated
1-CSB-PA801250LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LDHD Antibody, FITC conjugated
1-CSB-PA801250LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LDHD Antibody, Biotin conjugated
1-CSB-PA801250LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human LDHD ELISA Kit
ELA-E1698h	Lifescience Market	96 Tests	EUR 824

LDHD ELISA KIT|Human
EF009653	Lifescience Market	96 Tests	EUR 689

Human LDHD shRNA Plasmid
20-abx966195	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse LDHD shRNA Plasmid
20-abx974287	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LDHD Recombinant Protein (Human)
RP017650	ABM	100 ug	Ask for price

LDHD Recombinant Protein (Rat)
RP207959	ABM	100 ug	Ask for price

LDHD Recombinant Protein (Mouse)
RP147164	ABM	100 ug	Ask for price

Rat LDHD ELISA Kit
STJ150057	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of D-LDH in Rat serum, plasma and other biological fluids

Polyclonal LDHD Antibody (N-term)
APR05672G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDHD (N-term). This antibody is tested and proven to work in the following applications:

Lactate Dehydrogenase D (LDHD) Antibody
20-abx113429	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx126961	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx128330	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx134538	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
abx145634-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx173292	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Lactate Dehydrogenase D (LDHD) Antibody
abx032602-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
abx032602-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

LDHD Rabbit Polyclonal Conjugated Antibody
C38105	SAB	100ul	EUR 397

Lactate Dehydrogenase D (LDHD) Antibody
abx234741-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx326977	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx318606	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

LDHD Polyclonal Antibody, HRP Conjugated
A65963	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

LDHD Polyclonal Antibody, FITC Conjugated
A65964	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

LDHD Polyclonal Antibody, Biotin Conjugated
A65965	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Ldhd ORF Vector (Rat) (pORF)
ORF069321	ABM	1.0 ug DNA	EUR 506

LDHD ORF Vector (Human) (pORF)
ORF005884	ABM	1.0 ug DNA	EUR 95

Ldhd ORF Vector (Mouse) (pORF)
ORF049056	ABM	1.0 ug DNA	EUR 506

Recombinant Lactate Dehydrogenase D (LDHD)
4-RPE130Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q86WU2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 51.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Lactate Dehydrogenase D expressed in: E.coli

LDHD ELISA Kit (Mouse) (OKCA02374)
OKCA02374	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 1.17 mU/mL

LDHD ELISA Kit (Human) (OKCD08603)
OKCD08603	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The exact functions of LDHD remain unknown.The protein encoded by this gene belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family. The similar protein in yeast has both D-lactate and D-glycerate dehydrogenase activities. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.59ng/mL

LDHD ELISA Kit (Human) (OKEH01221)
OKEH01221	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The protein encoded by this gene belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family. The similar protein in yeast has both D-lactate and D-glycerate dehydrogenase activities. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL

LDHD ELISA Kit (Mouse) (OKEH05369)
OKEH05369	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78U/mL

Human Lactate Dehydrogenase D (LDHD) Protein
20-abx168150	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Lactate Dehydrogenase D (LDHD) Antibody (HRP)
20-abx308426	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody (FITC)
20-abx308427	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody (Biotin)
20-abx308428	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ldhd sgRNA CRISPR Lentivector set (Rat)
K6101501	ABM	3 x 1.0 ug	EUR 339

Ldhd sgRNA CRISPR Lentivector set (Mouse)
K3138201	ABM	3 x 1.0 ug	EUR 339

LDHD sgRNA CRISPR Lentivector set (Human)
K1205801	ABM	3 x 1.0 ug	EUR 339

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
abx053234-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-10 working days.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
20-abx152182	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Lactate Dehydrogenase D (LDHD) ELISA Kit
abx255322-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Lactate Dehydrogenase D (LDHD) ELISA Kit
abx256875-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Sheep Lactate Dehydrogenase D (LDHD) ELISA Kit
abx257102-96tests	Abbexa	96 tests	EUR 864
Shipped within 5-12 working days.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
abx252339-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Monkey Lactate Dehydrogenase D (LDHD) ELISA Kit
abx359717-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Pig Lactate Dehydrogenase D (LDHD) ELISA Kit
abx361256-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Rabbit Lactate Dehydrogenase D (LDHD) ELISA Kit
abx362813-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Lactate Dehydrogenase D (LDHD) ELISA Kit
abx356517-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.