LEP

Bovine Leptin (LEP) ELISA Kit
DLR-LEP-b-96T	DL Develop	96T	EUR 715
Should the Bovine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine Leptin (LEP) ELISA Kit
DLR-LEP-c-48T	DL Develop	48T	EUR 527
Should the Canine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Leptin (LEP) in samples from serum, plasma or other biological fluids.

Canine Leptin (LEP) ELISA Kit
DLR-LEP-c-96T	DL Develop	96T	EUR 688
Should the Canine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Leptin (LEP) in samples from serum, plasma or other biological fluids.

Chicken Leptin (LEP) ELISA Kit
DLR-LEP-Ch-48T	DL Develop	48T	EUR 508
Should the Chicken Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Leptin (LEP) in samples from serum, plasma or other biological fluids.

Chicken Leptin (LEP) ELISA Kit
DLR-LEP-Ch-96T	DL Develop	96T	EUR 661
Should the Chicken Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Leptin (LEP) in samples from serum, plasma or other biological fluids.

Equine Leptin (LEP) ELISA Kit
DLR-LEP-Eq-48T	DL Develop	48T	EUR 556
Should the Equine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Equine Leptin (LEP) in samples from serum, plasma or other biological fluids.

Equine Leptin (LEP) ELISA Kit
DLR-LEP-Eq-96T	DL Develop	96T	EUR 728
Should the Equine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Equine Leptin (LEP) in samples from serum, plasma or other biological fluids.

Goat Leptin (LEP) ELISA Kit
DLR-LEP-g-48T	DL Develop	48T	EUR 556
Should the Goat Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Goat Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Goat Leptin (LEP) ELISA Kit
DLR-LEP-g-96T	DL Develop	96T	EUR 728
Should the Goat Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Goat Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Leptin (LEP) ELISA Kit
DLR-LEP-Hu-48T	DL Develop	48T	EUR 392
Should the Human Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leptin (LEP) in samples from serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Leptin (LEP) ELISA Kit
DLR-LEP-Hu-96T	DL Develop	96T	EUR 502
Should the Human Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leptin (LEP) in samples from serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Leptin (LEP) ELISA Kit
DLR-LEP-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Leptin (LEP) ELISA Kit
DLR-LEP-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Leptin (LEP) ELISA Kit
DLR-LEP-p-48T	DL Develop	48T	EUR 547
Should the Porcine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Leptin (LEP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Porcine Leptin (LEP) ELISA Kit
DLR-LEP-p-96T	DL Develop	96T	EUR 715
Should the Porcine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Leptin (LEP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Leptin (LEP) ELISA Kit
DLR-LEP-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Leptin (LEP) ELISA Kit
DLR-LEP-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit Leptin (LEP) ELISA Kit
DLR-LEP-Rb-48T	DL Develop	48T	EUR 508
Should the Rabbit Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Leptin (LEP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rabbit Leptin (LEP) ELISA Kit
DLR-LEP-Rb-96T	DL Develop	96T	EUR 661
Should the Rabbit Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Leptin (LEP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Leptin (LEP) ELISA Kit
RD-LEP-b-48Tests	Reddot Biotech	48 Tests	EUR 555

Bovine Leptin (LEP) ELISA Kit
RD-LEP-b-96Tests	Reddot Biotech	96 Tests	EUR 771

Canine Leptin (LEP) ELISA Kit
RD-LEP-c-48Tests	Reddot Biotech	48 Tests	EUR 533

Canine Leptin (LEP) ELISA Kit
RD-LEP-c-96Tests	Reddot Biotech	96 Tests	EUR 740

Chicken Leptin (LEP) ELISA Kit
RD-LEP-Ch-48Tests	Reddot Biotech	48 Tests	EUR 511

Chicken Leptin (LEP) ELISA Kit
RD-LEP-Ch-96Tests	Reddot Biotech	96 Tests	EUR 709

Equine Leptin (LEP) ELISA Kit
RD-LEP-Eq-48Tests	Reddot Biotech	48 Tests	EUR 566

Equine Leptin (LEP) ELISA Kit
RD-LEP-Eq-96Tests	Reddot Biotech	96 Tests	EUR 787

Goat Leptin (LEP) ELISA Kit
RD-LEP-g-48Tests	Reddot Biotech	48 Tests	EUR 566

Goat Leptin (LEP) ELISA Kit
RD-LEP-g-96Tests	Reddot Biotech	96 Tests	EUR 787

Human Leptin (LEP) ELISA Kit
RD-LEP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 380

Human Leptin (LEP) ELISA Kit
RD-LEP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 521

Mouse Leptin (LEP) ELISA Kit
RD-LEP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Leptin (LEP) ELISA Kit
RD-LEP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Porcine Leptin (LEP) ELISA Kit
RD-LEP-p-48Tests	Reddot Biotech	48 Tests	EUR 555

Porcine Leptin (LEP) ELISA Kit
RD-LEP-p-96Tests	Reddot Biotech	96 Tests	EUR 771

Rat Leptin (LEP) ELISA Kit
RD-LEP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Leptin (LEP) ELISA Kit
RD-LEP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Rabbit Leptin (LEP) ELISA Kit
RD-LEP-Rb-48Tests	Reddot Biotech	48 Tests	EUR 511

Rabbit Leptin (LEP) ELISA Kit
RD-LEP-Rb-96Tests	Reddot Biotech	96 Tests	EUR 709

Bovine Leptin (LEP) ELISA Kit
RDR-LEP-b-48Tests	Reddot Biotech	48 Tests	EUR 580

Bovine Leptin (LEP) ELISA Kit
RDR-LEP-b-96Tests	Reddot Biotech	96 Tests	EUR 807

Canine Leptin (LEP) ELISA Kit
RDR-LEP-c-48Tests	Reddot Biotech	48 Tests	EUR 557

Canine Leptin (LEP) ELISA Kit
RDR-LEP-c-96Tests	Reddot Biotech	96 Tests	EUR 774

Chicken Leptin (LEP) ELISA Kit
RDR-LEP-Ch-48Tests	Reddot Biotech	48 Tests	EUR 534

Chicken Leptin (LEP) ELISA Kit
RDR-LEP-Ch-96Tests	Reddot Biotech	96 Tests	EUR 742

Equine Leptin (LEP) ELISA Kit
RDR-LEP-Eq-48Tests	Reddot Biotech	48 Tests	EUR 591

Equine Leptin (LEP) ELISA Kit
RDR-LEP-Eq-96Tests	Reddot Biotech	96 Tests	EUR 823

Goat Leptin (LEP) ELISA Kit
RDR-LEP-g-48Tests	Reddot Biotech	48 Tests	EUR 591

Goat Leptin (LEP) ELISA Kit
RDR-LEP-g-96Tests	Reddot Biotech	96 Tests	EUR 823

Human Leptin (LEP) ELISA Kit
RDR-LEP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 396

Human Leptin (LEP) ELISA Kit
RDR-LEP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 545

Mouse Leptin (LEP) ELISA Kit
RDR-LEP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Leptin (LEP) ELISA Kit
RDR-LEP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Porcine Leptin (LEP) ELISA Kit
RDR-LEP-p-48Tests	Reddot Biotech	48 Tests	EUR 580

Porcine Leptin (LEP) ELISA Kit
RDR-LEP-p-96Tests	Reddot Biotech	96 Tests	EUR 807

Rat Leptin (LEP) ELISA Kit
RDR-LEP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Leptin (LEP) ELISA Kit
RDR-LEP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Rabbit Leptin (LEP) ELISA Kit
RDR-LEP-Rb-48Tests	Reddot Biotech	48 Tests	EUR 534

Rabbit Leptin (LEP) ELISA Kit
RDR-LEP-Rb-96Tests	Reddot Biotech	96 Tests	EUR 742

LEP siRNA
20-abx902960	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LEP siRNA
20-abx922451	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LEP siRNA
20-abx922452	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LEP Antibody
42718-100ul	SAB	100ul	EUR 252

LEP Antibody
32965-100ul	SAB	100ul	EUR 252

LEP antibody
70R-18251	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal LEP antibody

LEP Antibody
1-CSB-PA012870GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LEP. Recognizes LEP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

LEP Antibody
1-CSB-PA012870LA01BO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LEP. Recognizes LEP from Bovine. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

LEP Antibody
1-CSB-PA255218	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LEP. Recognizes LEP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

LEP Antibody
1-CSB-PA223042	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LEP. Recognizes LEP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

LEP Antibody
1-CSB-PA009805	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LEP. Recognizes LEP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

LEP Antibody
1-CSB-PA06799A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LEP. Recognizes LEP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

LEP Antibody
1-CSB-PA033492	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LEP. Recognizes LEP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

Active Leptin (LEP)
4-APA084Hu01	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P41159 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 46.0kDa Isoelectric Point: 5.7
Description: Recombinant Human Leptin expressed in: E.coli

LEP Conjugated Antibody
C32965	SAB	100ul	EUR 397

LEP cloning plasmid
CSB-CL012870HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 504 Sequence: atgcattggggaaccctgtgcggattcttgtggctttggccctatcttttctatgcccaagctgtgcccatccaaaaagtccaagatgacaccaaaaccctcatcaagacaattgtcaccaggatcaatgacatttcacacacgcagtcagtctcctccaaacagaaagtcaccgg Show more
Description: A cloning plasmid for the LEP gene.

Leptin (LEP) Antibody
20-abx113462	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Leptin (LEP) Antibody
20-abx132012	Abbexa	EUR 356.00 EUR 913.00 EUR 467.00 EUR 154.00 EUR 272.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Leptin (LEP) Antibody
20-abx132013	Abbexa	EUR 328.00 EUR 801.00 EUR 425.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Leptin (LEP) Antibody
20-abx132014	Abbexa	EUR 328.00 EUR 843.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-12 working days.

Leptin (LEP) Antibody
20-abx109965	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Leptin (LEP) Antibody
20-abx135716	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Leptin (LEP) Antibody
20-abx137024	Abbexa	EUR 356.00 EUR 523.00	0.5 mg 1 mg
Shipped within 5-10 working days.

Leptin (LEP) Antibody
20-abx104838	Abbexa	EUR 453.00 EUR 133.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Leptin (LEP) Antibody
20-abx100045	Abbexa	EUR 342.00 EUR 133.00 EUR 940.00 EUR 481.00 EUR 286.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Leptin (LEP) Antibody
20-abx100046	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Leptin (LEP) Antibody
20-abx100047	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Leptin (LEP) Antibody
20-abx100048	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Leptin (LEP) Antibody
abx032702-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Leptin (LEP) Antibody
abx032702-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Leptin (LEP) Antibody
abx022492-1mg	Abbexa	1 mg	EUR 1121
Shipped within 5-10 working days.

Leptin (LEP) Antibody
abx022494-1mg	Abbexa	1 mg	EUR 1121
Shipped within 5-10 working days.

Leptin (LEP) Antibody
abx022495-05mg	Abbexa	0.5 mg	EUR 648
Shipped within 5-10 working days.

Leptin (LEP) Antibody
abx022496-01ml	Abbexa	0.1 ml	EUR 815
Shipped within 5-10 working days.

Leptin (LEP) Antibody
abx023905-1mg	Abbexa	1 mg	EUR 801
Shipped within 5-10 working days.

Leptin (LEP) Antibody
20-abx004338	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.