Bovine Leptin (LEP) ELISA Kit

DLR-LEP-b-96T 96T
EUR 715
  • Should the Bovine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine Leptin (LEP) ELISA Kit

DLR-LEP-c-48T 48T
EUR 527
  • Should the Canine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Leptin (LEP) in samples from serum, plasma or other biological fluids.

Canine Leptin (LEP) ELISA Kit

DLR-LEP-c-96T 96T
EUR 688
  • Should the Canine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Leptin (LEP) in samples from serum, plasma or other biological fluids.

Chicken Leptin (LEP) ELISA Kit

DLR-LEP-Ch-48T 48T
EUR 508
  • Should the Chicken Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Leptin (LEP) in samples from serum, plasma or other biological fluids.

Chicken Leptin (LEP) ELISA Kit

DLR-LEP-Ch-96T 96T
EUR 661
  • Should the Chicken Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Leptin (LEP) in samples from serum, plasma or other biological fluids.

Equine Leptin (LEP) ELISA Kit

DLR-LEP-Eq-48T 48T
EUR 556
  • Should the Equine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Equine Leptin (LEP) in samples from serum, plasma or other biological fluids.

Equine Leptin (LEP) ELISA Kit

DLR-LEP-Eq-96T 96T
EUR 728
  • Should the Equine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Equine Leptin (LEP) in samples from serum, plasma or other biological fluids.

Goat Leptin (LEP) ELISA Kit

DLR-LEP-g-48T 48T
EUR 556
  • Should the Goat Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Goat Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Goat Leptin (LEP) ELISA Kit

DLR-LEP-g-96T 96T
EUR 728
  • Should the Goat Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Goat Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Leptin (LEP) ELISA Kit

DLR-LEP-Hu-48T 48T
EUR 392
  • Should the Human Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leptin (LEP) in samples from serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Leptin (LEP) ELISA Kit

DLR-LEP-Hu-96T 96T
EUR 502
  • Should the Human Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leptin (LEP) in samples from serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Leptin (LEP) ELISA Kit

DLR-LEP-Mu-48T 48T
EUR 489
  • Should the Mouse Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Leptin (LEP) ELISA Kit

DLR-LEP-Mu-96T 96T
EUR 635
  • Should the Mouse Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Leptin (LEP) ELISA Kit

DLR-LEP-p-48T 48T
EUR 547
  • Should the Porcine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Leptin (LEP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Porcine Leptin (LEP) ELISA Kit

DLR-LEP-p-96T 96T
EUR 715
  • Should the Porcine Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Leptin (LEP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Leptin (LEP) ELISA Kit

DLR-LEP-Ra-48T 48T
EUR 508
  • Should the Rat Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Leptin (LEP) ELISA Kit

DLR-LEP-Ra-96T 96T
EUR 661
  • Should the Rat Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Leptin (LEP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit Leptin (LEP) ELISA Kit

DLR-LEP-Rb-48T 48T
EUR 508
  • Should the Rabbit Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Leptin (LEP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rabbit Leptin (LEP) ELISA Kit

DLR-LEP-Rb-96T 96T
EUR 661
  • Should the Rabbit Leptin (LEP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Leptin (LEP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Leptin (LEP) ELISA Kit

RD-LEP-b-48Tests 48 Tests
EUR 555

Bovine Leptin (LEP) ELISA Kit

RD-LEP-b-96Tests 96 Tests
EUR 771

Canine Leptin (LEP) ELISA Kit

RD-LEP-c-48Tests 48 Tests
EUR 533

Canine Leptin (LEP) ELISA Kit

RD-LEP-c-96Tests 96 Tests
EUR 740

Chicken Leptin (LEP) ELISA Kit

RD-LEP-Ch-48Tests 48 Tests
EUR 511

Chicken Leptin (LEP) ELISA Kit

RD-LEP-Ch-96Tests 96 Tests
EUR 709

Equine Leptin (LEP) ELISA Kit

RD-LEP-Eq-48Tests 48 Tests
EUR 566

Equine Leptin (LEP) ELISA Kit

RD-LEP-Eq-96Tests 96 Tests
EUR 787

Goat Leptin (LEP) ELISA Kit

RD-LEP-g-48Tests 48 Tests
EUR 566

Goat Leptin (LEP) ELISA Kit

RD-LEP-g-96Tests 96 Tests
EUR 787

Human Leptin (LEP) ELISA Kit

RD-LEP-Hu-48Tests 48 Tests
EUR 380

Human Leptin (LEP) ELISA Kit

RD-LEP-Hu-96Tests 96 Tests
EUR 521

Mouse Leptin (LEP) ELISA Kit

RD-LEP-Mu-48Tests 48 Tests
EUR 489

Mouse Leptin (LEP) ELISA Kit

RD-LEP-Mu-96Tests 96 Tests
EUR 677

Porcine Leptin (LEP) ELISA Kit

RD-LEP-p-48Tests 48 Tests
EUR 555

Porcine Leptin (LEP) ELISA Kit

RD-LEP-p-96Tests 96 Tests
EUR 771

Rat Leptin (LEP) ELISA Kit

RD-LEP-Ra-48Tests 48 Tests
EUR 511

Rat Leptin (LEP) ELISA Kit

RD-LEP-Ra-96Tests 96 Tests
EUR 709

Rabbit Leptin (LEP) ELISA Kit

RD-LEP-Rb-48Tests 48 Tests
EUR 511

Rabbit Leptin (LEP) ELISA Kit

RD-LEP-Rb-96Tests 96 Tests
EUR 709

Bovine Leptin (LEP) ELISA Kit

RDR-LEP-b-48Tests 48 Tests
EUR 580

Bovine Leptin (LEP) ELISA Kit

RDR-LEP-b-96Tests 96 Tests
EUR 807

Canine Leptin (LEP) ELISA Kit

RDR-LEP-c-48Tests 48 Tests
EUR 557

Canine Leptin (LEP) ELISA Kit

RDR-LEP-c-96Tests 96 Tests
EUR 774

Chicken Leptin (LEP) ELISA Kit

RDR-LEP-Ch-48Tests 48 Tests
EUR 534

Chicken Leptin (LEP) ELISA Kit

RDR-LEP-Ch-96Tests 96 Tests
EUR 742

Equine Leptin (LEP) ELISA Kit

RDR-LEP-Eq-48Tests 48 Tests
EUR 591

Equine Leptin (LEP) ELISA Kit

RDR-LEP-Eq-96Tests 96 Tests
EUR 823

Goat Leptin (LEP) ELISA Kit

RDR-LEP-g-48Tests 48 Tests
EUR 591

Goat Leptin (LEP) ELISA Kit

RDR-LEP-g-96Tests 96 Tests
EUR 823

Human Leptin (LEP) ELISA Kit

RDR-LEP-Hu-48Tests 48 Tests
EUR 396

Human Leptin (LEP) ELISA Kit

RDR-LEP-Hu-96Tests 96 Tests
EUR 545

Mouse Leptin (LEP) ELISA Kit

RDR-LEP-Mu-48Tests 48 Tests
EUR 511

Mouse Leptin (LEP) ELISA Kit

RDR-LEP-Mu-96Tests 96 Tests
EUR 709

Porcine Leptin (LEP) ELISA Kit

RDR-LEP-p-48Tests 48 Tests
EUR 580

Porcine Leptin (LEP) ELISA Kit

RDR-LEP-p-96Tests 96 Tests
EUR 807

Rat Leptin (LEP) ELISA Kit

RDR-LEP-Ra-48Tests 48 Tests
EUR 534

Rat Leptin (LEP) ELISA Kit

RDR-LEP-Ra-96Tests 96 Tests
EUR 742

Rabbit Leptin (LEP) ELISA Kit

RDR-LEP-Rb-48Tests 48 Tests
EUR 534

Rabbit Leptin (LEP) ELISA Kit

RDR-LEP-Rb-96Tests 96 Tests
EUR 742


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LEP Antibody

42718-100ul 100ul
EUR 252

LEP Antibody

32965-100ul 100ul
EUR 252

LEP antibody

70R-18251 50 ul
EUR 435
Description: Rabbit polyclonal LEP antibody

LEP Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LEP. Recognizes LEP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

LEP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LEP. Recognizes LEP from Bovine. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

LEP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LEP. Recognizes LEP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

LEP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LEP. Recognizes LEP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

LEP Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LEP. Recognizes LEP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

LEP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LEP. Recognizes LEP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

LEP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LEP. Recognizes LEP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

Active Leptin (LEP)

  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P41159
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 46.0kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Leptin expressed in: E.coli

LEP Conjugated Antibody

C32965 100ul
EUR 397

LEP cloning plasmid

CSB-CL012870HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 504
  • Sequence: atgcattggggaaccctgtgcggattcttgtggctttggccctatcttttctatgcccaagctgtgcccatccaaaaagtccaagatgacaccaaaaccctcatcaagacaattgtcaccaggatcaatgacatttcacacacgcagtcagtctcctccaaacagaaagtcaccgg
  • Show more
Description: A cloning plasmid for the LEP gene.

Leptin (LEP) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leptin (LEP) Antibody

  • EUR 356.00
  • EUR 913.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Leptin (LEP) Antibody

  • EUR 328.00
  • EUR 801.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Leptin (LEP) Antibody

  • EUR 328.00
  • EUR 843.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Leptin (LEP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leptin (LEP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leptin (LEP) Antibody

  • EUR 356.00
  • EUR 523.00
  • 0.5 mg
  • 1 mg
  • Shipped within 5-10 working days.

Leptin (LEP) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Leptin (LEP) Antibody

  • EUR 342.00
  • EUR 133.00
  • EUR 940.00
  • EUR 481.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Leptin (LEP) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Leptin (LEP) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Leptin (LEP) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Leptin (LEP) Antibody

abx032702-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Leptin (LEP) Antibody

abx032702-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Leptin (LEP) Antibody

abx022492-1mg 1 mg
EUR 1121
  • Shipped within 5-10 working days.

Leptin (LEP) Antibody

abx022494-1mg 1 mg
EUR 1121
  • Shipped within 5-10 working days.

Leptin (LEP) Antibody

abx022495-05mg 0.5 mg
EUR 648
  • Shipped within 5-10 working days.

Leptin (LEP) Antibody

abx022496-01ml 0.1 ml
EUR 815
  • Shipped within 5-10 working days.

Leptin (LEP) Antibody

abx023905-1mg 1 mg
EUR 801
  • Shipped within 5-10 working days.

Leptin (LEP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.