Bovine Lactoferrin (LTF) ELISA Kit

DLR-LTF-b-96T 96T
EUR 715
  • Should the Bovine Lactoferrin (LTF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Lactoferrin (LTF) in samples from serum, plasma, tissue homogenates, cell lysates, saliva, milk, cell culture supernates or other biological fluids.

Canine Lactoferrin (LTF) ELISA Kit

DLR-LTF-c-48T 48T
EUR 527
  • Should the Canine Lactoferrin (LTF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Lactoferrin (LTF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine Lactoferrin (LTF) ELISA Kit

DLR-LTF-c-96T 96T
EUR 688
  • Should the Canine Lactoferrin (LTF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Lactoferrin (LTF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Lactoferrin (LTF) ELISA Kit

DLR-LTF-Hu-48T 48T
EUR 401
  • Should the Human Lactoferrin (LTF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lactoferrin (LTF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Lactoferrin (LTF) ELISA Kit

DLR-LTF-Hu-96T 96T
EUR 514
  • Should the Human Lactoferrin (LTF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lactoferrin (LTF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Lactoferrin (LTF) ELISA Kit

DLR-LTF-Mu-48T 48T
EUR 489
  • Should the Mouse Lactoferrin (LTF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lactoferrin (LTF) in samples from serum, plasma, breast milk or other biological fluids.

Mouse Lactoferrin (LTF) ELISA Kit

DLR-LTF-Mu-96T 96T
EUR 635
  • Should the Mouse Lactoferrin (LTF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lactoferrin (LTF) in samples from serum, plasma, breast milk or other biological fluids.

Porcine Lactoferrin (LTF) ELISA Kit

DLR-LTF-p-48T 48T
EUR 547
  • Should the Porcine Lactoferrin (LTF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Lactoferrin (LTF) in samples from serum, plasma or other biological fluids.

Porcine Lactoferrin (LTF) ELISA Kit

DLR-LTF-p-96T 96T
EUR 715
  • Should the Porcine Lactoferrin (LTF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Lactoferrin (LTF) in samples from serum, plasma or other biological fluids.

Rat Lactoferrin (LTF) ELISA Kit

DLR-LTF-Ra-48T 48T
EUR 508
  • Should the Rat Lactoferrin (LTF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lactoferrin (LTF) in samples from serum, plasma or other biological fluids.

Rat Lactoferrin (LTF) ELISA Kit

DLR-LTF-Ra-96T 96T
EUR 661
  • Should the Rat Lactoferrin (LTF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lactoferrin (LTF) in samples from serum, plasma or other biological fluids.

Bovine Lactoferrin (LTF) ELISA Kit

RD-LTF-b-48Tests 48 Tests
EUR 555

Bovine Lactoferrin (LTF) ELISA Kit

RD-LTF-b-96Tests 96 Tests
EUR 771

Canine Lactoferrin (LTF) ELISA Kit

RD-LTF-c-48Tests 48 Tests
EUR 533

Canine Lactoferrin (LTF) ELISA Kit

RD-LTF-c-96Tests 96 Tests
EUR 740

Human Lactoferrin (LTF) ELISA Kit

RD-LTF-Hu-48Tests 48 Tests
EUR 390

Human Lactoferrin (LTF) ELISA Kit

RD-LTF-Hu-96Tests 96 Tests
EUR 536

Mouse Lactoferrin (LTF) ELISA Kit

RD-LTF-Mu-48Tests 48 Tests
EUR 489

Mouse Lactoferrin (LTF) ELISA Kit

RD-LTF-Mu-96Tests 96 Tests
EUR 677

Porcine Lactoferrin (LTF) ELISA Kit

RD-LTF-p-48Tests 48 Tests
EUR 555

Porcine Lactoferrin (LTF) ELISA Kit

RD-LTF-p-96Tests 96 Tests
EUR 771

Rat Lactoferrin (LTF) ELISA Kit

RD-LTF-Ra-48Tests 48 Tests
EUR 511

Rat Lactoferrin (LTF) ELISA Kit

RD-LTF-Ra-96Tests 96 Tests
EUR 709

Bovine Lactoferrin (LTF) ELISA Kit

RDR-LTF-b-48Tests 48 Tests
EUR 580

Bovine Lactoferrin (LTF) ELISA Kit

RDR-LTF-b-96Tests 96 Tests
EUR 807

Canine Lactoferrin (LTF) ELISA Kit

RDR-LTF-c-48Tests 48 Tests
EUR 557

Canine Lactoferrin (LTF) ELISA Kit

RDR-LTF-c-96Tests 96 Tests
EUR 774

Human Lactoferrin (LTF) ELISA Kit

RDR-LTF-Hu-48Tests 48 Tests
EUR 407

Human Lactoferrin (LTF) ELISA Kit

RDR-LTF-Hu-96Tests 96 Tests
EUR 561

Mouse Lactoferrin (LTF) ELISA Kit

RDR-LTF-Mu-48Tests 48 Tests
EUR 511

Mouse Lactoferrin (LTF) ELISA Kit

RDR-LTF-Mu-96Tests 96 Tests
EUR 709

Porcine Lactoferrin (LTF) ELISA Kit

RDR-LTF-p-48Tests 48 Tests
EUR 580

Porcine Lactoferrin (LTF) ELISA Kit

RDR-LTF-p-96Tests 96 Tests
EUR 807

Rat Lactoferrin (LTF) ELISA Kit

RDR-LTF-Ra-48Tests 48 Tests
EUR 534

Rat Lactoferrin (LTF) ELISA Kit

RDR-LTF-Ra-96Tests 96 Tests
EUR 742


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LTF Antibody

ABD8059 100 ug
EUR 438

LTF Antibody

ABD8105 100 ug
EUR 438

LTF Antibody

36198-100ul 100ul
EUR 252

LTF antibody

70R-18331 50 ul
EUR 435
Description: Rabbit polyclonal LTF antibody

LTF Antibody

DF8059 200ul
EUR 304
Description: LTF Antibody detects endogenous levels of total LTF.

LTF Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LTF. Recognizes LTF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

LTF Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LTF. Recognizes LTF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

LTF Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LTF. Recognizes LTF from Human. This antibody is Unconjugated. Tested in the following application: ELISA

LTF Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LTF. Recognizes LTF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LTF Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LTF. Recognizes LTF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

LTF Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LTF. Recognizes LTF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:100-1:500, IF:1:50-1:500

LTF Plasmid

PVT7120 2 ug
EUR 266


PVT10016 2 ug
EUR 301

Active Lactoferrin (LTF)

  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • EUR 772.00
  • EUR 1444.00
  • EUR 490.00
  • EUR 5140.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02788
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Lactoferrin expressed in: Natural Extract

LTF Conjugated Antibody

C36198 100ul
EUR 397

LTF cloning plasmid

CSB-CL013229HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2136
  • Sequence: atgaaacttgtcttcctcgtcctgctgttcctcggggccctcggactgtgtctggctggcagtaggagaaggagtgttcagtggtgcgccgtatcccaacccgaggccacaaaatgcttccaatggcaaaggaatatgagaaaagtgcgtggccctcctgtcagctgcataaaga
  • Show more
Description: A cloning plasmid for the LTF gene.

LTF cloning plasmid

CSB-CL013229HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2136
  • Sequence: atgaaacttgtcttcctcgtcctgctgttcctcggggccctcggactgtgtctggctggcagtaggagaaggagtgttcagtggtgcgccgtatcccaacccgaggccacaaaatgcttccaatggcaaaggaatatgagaaaagtgcgtggccctcctgtcagctgcataaaga
  • Show more
Description: A cloning plasmid for the LTF gene.

Lactoferrin (LTF) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Lactoferrin (LTF) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lactoferrin (LTF) Antibody

  • EUR 328.00
  • EUR 133.00
  • EUR 885.00
  • EUR 453.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Lactoferrin (LTF) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactoferrin (LTF) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactoferrin (LTF) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactotransferrin (LTF) Antibody

  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactoferrin (LTF) Antibody

abx048499-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Lactoferrin (LTF) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactoferrin (LTF) Antibody

  • EUR 328.00
  • EUR 133.00
  • EUR 885.00
  • EUR 453.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Lactoferrin (LTF) Antibody

  • EUR 300.00
  • EUR 704.00
  • EUR 356.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactoferrin (LTF) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactoferrin (LTF) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactoferrin (LTF) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactoferrin (LTF) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactoferrin (LTF) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactoferrin (LTF) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactoferrin (LTF) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Lactotransferrin (LTF) Antibody

abx034070-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lactotransferrin (LTF) Antibody

abx034070-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Lactoferrin (LTF) Antibody

abx022490-1mg 1 mg
EUR 599
  • Shipped within 5-10 working days.

Lactoferrin (LTF) Antibody

abx022491-1mg 1 mg
EUR 599
  • Shipped within 5-10 working days.

Lactoferrin (LTF) Antibody

abx023314-2mg 2 mg
EUR 467
  • Shipped within 5-10 working days.

Lactotransferrin (LTF) Antibody

abx025182-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lactotransferrin (LTF) Antibody

abx025182-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Lactoferrin (LTF) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lactoferrin (LTF) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lactoferrin (LTF) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lactoferrin (LTF) Antibody

  • EUR 272.00
  • EUR 133.00
  • EUR 620.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactoferrin (LTF) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Lactoferrin (LTF) Antibody

  • EUR 1316.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lactotransferrin (LTF) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactotransferrin (LTF) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lactotransferrin (LTF) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lactoferrin (LTF) Antibody

abx432940-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Lactoferrin (LTF) Antibody

abx234674-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Lactotransferrin (LTF) Protein

  • EUR 5924.00
  • EUR 328.00
  • EUR 230.00
  • 10 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-10 working days.

LTF Rabbit pAb

A12902-100ul 100 ul
EUR 308

LTF Rabbit pAb

A12902-200ul 200 ul
EUR 459

LTF Rabbit pAb

A12902-20ul 20 ul
EUR 183

LTF Rabbit pAb

A12902-50ul 50 ul
EUR 223