  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LY6G6C Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LY6G6C Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LY6G6C Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LY6G6C cloning plasmid

CSB-CL013245HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 378
  • Sequence: atgaaagcccttatgctgctcaccctgtctgttctgctctgctgggtctcagctgacattcgctgtcactcctgctacaaggtccctgtgctgggctgtgtggaccggcagtcctgccgcctggagccaggacagcaatgcctgacaacacatgcataccttggtaagatgtgggt
  • Show more
Description: A cloning plasmid for the LY6G6C gene.

LY6G6C Polyclonal Antibody

A62910 100 µg
EUR 570.55
Description: The best epigenetics products


ELI-14269h 96 Tests
EUR 824


ELI-19628b 96 Tests
EUR 928

Mouse Ly6g6c ELISA KIT

ELI-27777m 96 Tests
EUR 865

Mouse LY6G6C shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LY6G6C Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6G6C. Recognizes LY6G6C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LY6G6C Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6G6C. Recognizes LY6G6C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LY6G6C Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6G6C. Recognizes LY6G6C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human LY6G6C shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LY6G6C Recombinant Protein (Human)

RP018442 100 ug Ask for price

LY6G6C Recombinant Protein (Mouse)

RP148694 100 ug Ask for price

LY6G6C Recombinant Protein (Rat)

RP210362 100 ug Ask for price

Polyclonal LY6G6C Antibody (C-term)

APR17257G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LY6G6C (C-term). This antibody is tested and proven to work in the following applications:

LY6G6C Polyclonal Antibody, HRP Conjugated

A62911 100 µg
EUR 570.55
Description: kits suitable for this type of research

LY6G6C Polyclonal Antibody, FITC Conjugated

A62912 100 µg
EUR 570.55
Description: fast delivery possible

LY6G6C Polyclonal Antibody, Biotin Conjugated

A62913 100 µg
EUR 570.55
Description: reagents widely cited

Ly6g6c ORF Vector (Rat) (pORF)

ORF070122 1.0 ug DNA
EUR 506

LY6G6C ORF Vector (Human) (pORF)

ORF006148 1.0 ug DNA
EUR 95

Ly6g6c ORF Vector (Mouse) (pORF)

ORF049566 1.0 ug DNA
EUR 506

Ly6g6c sgRNA CRISPR Lentivector set (Rat)

K7293401 3 x 1.0 ug
EUR 339

Ly6g6c sgRNA CRISPR Lentivector set (Mouse)

K4021401 3 x 1.0 ug
EUR 339

LY6G6C sgRNA CRISPR Lentivector set (Human)

K1245401 3 x 1.0 ug
EUR 339

Ly6g6c sgRNA CRISPR Lentivector (Rat) (Target 1)

K7293402 1.0 ug DNA
EUR 154

Ly6g6c sgRNA CRISPR Lentivector (Rat) (Target 2)

K7293403 1.0 ug DNA
EUR 154

Ly6g6c sgRNA CRISPR Lentivector (Rat) (Target 3)

K7293404 1.0 ug DNA
EUR 154

Ly6g6c sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4021402 1.0 ug DNA
EUR 154

Ly6g6c sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4021403 1.0 ug DNA
EUR 154

Ly6g6c sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4021404 1.0 ug DNA
EUR 154

LY6G6C sgRNA CRISPR Lentivector (Human) (Target 1)

K1245402 1.0 ug DNA
EUR 154

LY6G6C sgRNA CRISPR Lentivector (Human) (Target 2)

K1245403 1.0 ug DNA
EUR 154

LY6G6C sgRNA CRISPR Lentivector (Human) (Target 3)

K1245404 1.0 ug DNA
EUR 154

LY6G6C Protein Vector (Human) (pPB-C-His)

PV024589 500 ng
EUR 329

LY6G6C Protein Vector (Human) (pPB-N-His)

PV024590 500 ng
EUR 329

LY6G6C Protein Vector (Human) (pPM-C-HA)

PV024591 500 ng
EUR 329

LY6G6C Protein Vector (Human) (pPM-C-His)

PV024592 500 ng
EUR 329

LY6G6C Protein Vector (Rat) (pPB-C-His)

PV280486 500 ng
EUR 603

LY6G6C Protein Vector (Rat) (pPB-N-His)

PV280487 500 ng
EUR 603

LY6G6C Protein Vector (Rat) (pPM-C-HA)

PV280488 500 ng
EUR 603

LY6G6C Protein Vector (Rat) (pPM-C-His)

PV280489 500 ng
EUR 603

LY6G6C Protein Vector (Mouse) (pPB-C-His)

PV198262 500 ng
EUR 603

LY6G6C Protein Vector (Mouse) (pPB-N-His)

PV198263 500 ng
EUR 603

LY6G6C Protein Vector (Mouse) (pPM-C-HA)

PV198264 500 ng
EUR 603

LY6G6C Protein Vector (Mouse) (pPM-C-His)

PV198265 500 ng
EUR 603

Ly6g6c 3'UTR Luciferase Stable Cell Line

TU112721 1.0 ml Ask for price

Ly6g6c 3'UTR GFP Stable Cell Line

TU162721 1.0 ml Ask for price

Ly6g6c 3'UTR Luciferase Stable Cell Line

TU212691 1.0 ml Ask for price

Ly6g6c 3'UTR GFP Stable Cell Line

TU262691 1.0 ml Ask for price

LY6G6C 3'UTR GFP Stable Cell Line

TU062772 1.0 ml
EUR 1394

LY6G6C 3'UTR Luciferase Stable Cell Line

TU012772 1.0 ml
EUR 1394

LY6G6C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV649747 1.0 ug DNA
EUR 514

LY6G6C Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV649751 1.0 ug DNA
EUR 514

LY6G6C Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV649752 1.0 ug DNA
EUR 514

Lymphocyte Antigen 6 Complex Locus Protein G6c (LY6G6C) Antibody

abx025772-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lymphocyte Antigen 6 Complex Locus Protein G6c (LY6G6C) Antibody

abx025772-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Lymphocyte Antigen 6 Complex Locus Protein G6c (LY6G6C) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7293405 3 x 1.0 ug
EUR 376

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4021405 3 x 1.0 ug
EUR 376

LY6G6C sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1245405 3 x 1.0 ug
EUR 376

LY6G6C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV649748 1.0 ug DNA
EUR 514

LY6G6C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV649749 1.0 ug DNA
EUR 572

LY6G6C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV649750 1.0 ug DNA
EUR 572

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7293406 1.0 ug DNA
EUR 167

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7293407 1.0 ug DNA
EUR 167

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7293408 1.0 ug DNA
EUR 167

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4021406 1.0 ug DNA
EUR 167

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4021407 1.0 ug DNA
EUR 167

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4021408 1.0 ug DNA
EUR 167

LY6G6C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1245406 1.0 ug DNA
EUR 167

LY6G6C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1245407 1.0 ug DNA
EUR 167

LY6G6C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1245408 1.0 ug DNA
EUR 167