LY6G6C

LY6G6C siRNA
20-abx923141	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LY6G6C siRNA
20-abx923142	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LY6G6C Antibody (HRP)
20-abx304404	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

LY6G6C Antibody (FITC)
20-abx304405	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

LY6G6C Antibody (Biotin)
20-abx304406	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

LY6G6C cloning plasmid
CSB-CL013245HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 378 Sequence: atgaaagcccttatgctgctcaccctgtctgttctgctctgctgggtctcagctgacattcgctgtcactcctgctacaaggtccctgtgctgggctgtgtggaccggcagtcctgccgcctggagccaggacagcaatgcctgacaacacatgcataccttggtaagatgtgggt Show more
Description: A cloning plasmid for the LY6G6C gene.

LY6G6C Polyclonal Antibody
A62910	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Human LY6G6C ELISA KIT
ELI-14269h	Lifescience Market	96 Tests	EUR 824

Bovine LY6G6C ELISA KIT
ELI-19628b	Lifescience Market	96 Tests	EUR 928

Mouse Ly6g6c ELISA KIT
ELI-27777m	Lifescience Market	96 Tests	EUR 865

Mouse LY6G6C shRNA Plasmid
20-abx976621	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LY6G6C Antibody, HRP conjugated
1-CSB-PA013245LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6G6C. Recognizes LY6G6C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LY6G6C Antibody, FITC conjugated
1-CSB-PA013245LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6G6C. Recognizes LY6G6C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LY6G6C Antibody, Biotin conjugated
1-CSB-PA013245LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LY6G6C. Recognizes LY6G6C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human LY6G6C shRNA Plasmid
20-abx962893	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LY6G6C Recombinant Protein (Human)
RP018442	ABM	100 ug	Ask for price

LY6G6C Recombinant Protein (Mouse)
RP148694	ABM	100 ug	Ask for price

LY6G6C Recombinant Protein (Rat)
RP210362	ABM	100 ug	Ask for price

Polyclonal LY6G6C Antibody (C-term)
APR17257G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LY6G6C (C-term). This antibody is tested and proven to work in the following applications:

LY6G6C Polyclonal Antibody, HRP Conjugated
A62911	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

LY6G6C Polyclonal Antibody, FITC Conjugated
A62912	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

LY6G6C Polyclonal Antibody, Biotin Conjugated
A62913	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Ly6g6c ORF Vector (Rat) (pORF)
ORF070122	ABM	1.0 ug DNA	EUR 506

LY6G6C ORF Vector (Human) (pORF)
ORF006148	ABM	1.0 ug DNA	EUR 95

Ly6g6c ORF Vector (Mouse) (pORF)
ORF049566	ABM	1.0 ug DNA	EUR 506

Ly6g6c sgRNA CRISPR Lentivector set (Rat)
K7293401	ABM	3 x 1.0 ug	EUR 339

Ly6g6c sgRNA CRISPR Lentivector set (Mouse)
K4021401	ABM	3 x 1.0 ug	EUR 339

LY6G6C sgRNA CRISPR Lentivector set (Human)
K1245401	ABM	3 x 1.0 ug	EUR 339

Ly6g6c sgRNA CRISPR Lentivector (Rat) (Target 1)
K7293402	ABM	1.0 ug DNA	EUR 154

Ly6g6c sgRNA CRISPR Lentivector (Rat) (Target 2)
K7293403	ABM	1.0 ug DNA	EUR 154

Ly6g6c sgRNA CRISPR Lentivector (Rat) (Target 3)
K7293404	ABM	1.0 ug DNA	EUR 154

Ly6g6c sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4021402	ABM	1.0 ug DNA	EUR 154

Ly6g6c sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4021403	ABM	1.0 ug DNA	EUR 154

Ly6g6c sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4021404	ABM	1.0 ug DNA	EUR 154

LY6G6C sgRNA CRISPR Lentivector (Human) (Target 1)
K1245402	ABM	1.0 ug DNA	EUR 154

LY6G6C sgRNA CRISPR Lentivector (Human) (Target 2)
K1245403	ABM	1.0 ug DNA	EUR 154

LY6G6C sgRNA CRISPR Lentivector (Human) (Target 3)
K1245404	ABM	1.0 ug DNA	EUR 154

LY6G6C Protein Vector (Human) (pPB-C-His)
PV024589	ABM	500 ng	EUR 329

LY6G6C Protein Vector (Human) (pPB-N-His)
PV024590	ABM	500 ng	EUR 329

LY6G6C Protein Vector (Human) (pPM-C-HA)
PV024591	ABM	500 ng	EUR 329

LY6G6C Protein Vector (Human) (pPM-C-His)
PV024592	ABM	500 ng	EUR 329

LY6G6C Protein Vector (Rat) (pPB-C-His)
PV280486	ABM	500 ng	EUR 603

LY6G6C Protein Vector (Rat) (pPB-N-His)
PV280487	ABM	500 ng	EUR 603

LY6G6C Protein Vector (Rat) (pPM-C-HA)
PV280488	ABM	500 ng	EUR 603

LY6G6C Protein Vector (Rat) (pPM-C-His)
PV280489	ABM	500 ng	EUR 603

LY6G6C Protein Vector (Mouse) (pPB-C-His)
PV198262	ABM	500 ng	EUR 603

LY6G6C Protein Vector (Mouse) (pPB-N-His)
PV198263	ABM	500 ng	EUR 603

LY6G6C Protein Vector (Mouse) (pPM-C-HA)
PV198264	ABM	500 ng	EUR 603

LY6G6C Protein Vector (Mouse) (pPM-C-His)
PV198265	ABM	500 ng	EUR 603

Ly6g6c 3'UTR Luciferase Stable Cell Line
TU112721	ABM	1.0 ml	Ask for price

Ly6g6c 3'UTR GFP Stable Cell Line
TU162721	ABM	1.0 ml	Ask for price

Ly6g6c 3'UTR Luciferase Stable Cell Line
TU212691	ABM	1.0 ml	Ask for price

Ly6g6c 3'UTR GFP Stable Cell Line
TU262691	ABM	1.0 ml	Ask for price

LY6G6C 3'UTR GFP Stable Cell Line
TU062772	ABM	1.0 ml	EUR 1394

LY6G6C 3'UTR Luciferase Stable Cell Line
TU012772	ABM	1.0 ml	EUR 1394

LY6G6C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV649747	ABM	1.0 ug DNA	EUR 514

LY6G6C Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV649751	ABM	1.0 ug DNA	EUR 514

LY6G6C Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV649752	ABM	1.0 ug DNA	EUR 514

Lymphocyte Antigen 6 Complex Locus Protein G6c (LY6G6C) Antibody
abx025772-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Lymphocyte Antigen 6 Complex Locus Protein G6c (LY6G6C) Antibody
abx025772-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Lymphocyte Antigen 6 Complex Locus Protein G6c (LY6G6C) Antibody
20-abx304403	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7293405	ABM	3 x 1.0 ug	EUR 376

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4021405	ABM	3 x 1.0 ug	EUR 376

LY6G6C sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1245405	ABM	3 x 1.0 ug	EUR 376

LY6G6C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV649748	ABM	1.0 ug DNA	EUR 514

LY6G6C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV649749	ABM	1.0 ug DNA	EUR 572

LY6G6C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV649750	ABM	1.0 ug DNA	EUR 572

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7293406	ABM	1.0 ug DNA	EUR 167

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7293407	ABM	1.0 ug DNA	EUR 167

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7293408	ABM	1.0 ug DNA	EUR 167

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4021406	ABM	1.0 ug DNA	EUR 167

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4021407	ABM	1.0 ug DNA	EUR 167

Ly6g6c sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4021408	ABM	1.0 ug DNA	EUR 167

LY6G6C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1245406	ABM	1.0 ug DNA	EUR 167

LY6G6C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1245407	ABM	1.0 ug DNA	EUR 167

LY6G6C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1245408	ABM	1.0 ug DNA	EUR 167