LYZ Antibody

ABD7890 100 ug
EUR 438

LYZ Antibody

ABD8128 100 ug
EUR 438

LYZ Antibody

35805-100ul 100ul
EUR 252

LYZ antibody

70R-18339 50 ul
EUR 435
Description: Rabbit polyclonal LYZ antibody

LYZ antibody

70R-10028 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LYZ antibody

LYZ antibody

70R-10029 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LYZ antibody

LYZ Antibody

DF7890 200ul
EUR 304
Description: LYZ Antibody detects endogenous levels of total LYZ.

LYZ Antibody

1-CSB-PA954164
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LYZ. Recognizes LYZ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

LYZ Antibody

1-CSB-PA013283DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LYZ. Recognizes LYZ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LYZ Antibody

1-CSB-PA013283GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LYZ. Recognizes LYZ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LYZ Antibody

1-CSB-PA292717
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LYZ. Recognizes LYZ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

LYZ Antibody

1-CSB-PA02769A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYZ. Recognizes LYZ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

pOTB7-LYZ

PVT18343 2 ug
EUR 231

LYZ Conjugated Antibody

C35805 100ul
EUR 397

LYZ cloning plasmid

CSB-CL013283HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 447
  • Sequence: atgaaggctctcattgttctggggcttgtcctcctttctgttacggtccagggcaaggtctttgaaaggtgtgagttggccagaactctgaaaagattgggaatggatggctacaggggaatcagcctagcaaactggatgtgtttggccaaatgggagagtggttacaacacacg
  • Show more
Description: A cloning plasmid for the LYZ gene.

LYZ Rabbit mAb

A10972-100ul 100 ul
EUR 384

LYZ Rabbit mAb

A10972-200ul 200 ul
EUR 554

LYZ Rabbit mAb

A10972-20ul 20 ul
EUR 221

LYZ Rabbit mAb

A10972-50ul 50 ul
EUR 265

LYZ Rabbit pAb

A12919-100ul 100 ul
EUR 308

LYZ Rabbit pAb

A12919-200ul 200 ul
EUR 459

LYZ Rabbit pAb

A12919-20ul 20 ul
EUR 183

LYZ Rabbit pAb

A12919-50ul 50 ul
EUR 223

LYZ Polyclonal Antibody

A50616 100 µg
EUR 570.55
Description: The best epigenetics products

LYZ Rabbit pAb

A13511-100ul 100 ul
EUR 308

LYZ Rabbit pAb

A13511-200ul 200 ul
EUR 459

LYZ Rabbit pAb

A13511-20ul 20 ul
EUR 183

LYZ Rabbit pAb

A13511-50ul 50 ul
EUR 223

LYZ Rabbit pAb

A2503-100ul 100 ul
EUR 308

LYZ Rabbit pAb

A2503-200ul 200 ul
EUR 459

LYZ Rabbit pAb

A2503-20ul 20 ul
EUR 183

LYZ Rabbit pAb

A2503-50ul 50 ul
EUR 223

LYZ Blocking Peptide

33R-3787 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LYZ antibody, catalog no. 70R-10028

LYZ Blocking Peptide

33R-1730 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LYZ antibody, catalog no. 70R-10029

LYZ Monoclonal Antibody

27511-100ul 100ul
EUR 252

LYZ Monoclonal Antibody

27511-50ul 50ul
EUR 187

LYZ Blocking Peptide

DF7890-BP 1mg
EUR 195

Anti-LYZ Antibody

STJ503098 100 µg
EUR 476

Anti-LYZ antibody

STJ24437 100 µl
EUR 277
Description: This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-4]glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the antimicrobial agents found in human milk, and is also present in spleen, lung, kidney, white blood cells, plasma, saliva, and tears. The protein has antibacterial activity against a number of bacterial species. Missense mutations in this gene have been identified in heritable renal amyloidosis.

Anti-LYZ antibody

STJ112860 100 µl
EUR 393
Description: This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-4]glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the antimicrobial agents found in human milk, and is also present in spleen, lung, kidney, white blood cells, plasma, saliva, and tears. The protein has antibacterial activity against a number of bacterial species. Missense mutations in this gene have been identified in heritable renal amyloidosis.

Anti-LYZ antibody

STJ114785 100 µl
EUR 277
Description: This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-4]glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the antimicrobial agents found in human milk, and is also present in spleen, lung, kidney, white blood cells, plasma, saliva, and tears. The protein has antibacterial activity against a number of bacterial species. Missense mutations in this gene have been identified in heritable renal amyloidosis.

Anti-LYZ antibody

STJ115472 100 µl
EUR 277
Description: This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-4]glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the antimicrobial agents found in human milk, and is also present in spleen, lung, kidney, white blood cells, plasma, saliva, and tears. The protein has antibacterial activity against a number of bacterial species. Missense mutations in this gene have been identified in heritable renal amyloidosis.

Polyclonal LYZ / Lysozyme Antibody

APR03192G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LYZ / Lysozyme . This antibody is tested and proven to work in the following applications:

LYZ Monoclonal Conjugated Antibody

C27511 100ul
EUR 397

Human LYZ ELISA Kit

ELA-E1193h 96 Tests
EUR 824

Lysozyme C (LYZ) Antibody

20-abx125359
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lysozyme C (LYZ) Antibody

20-abx126965
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Lysozyme C (LYZ) Antibody

20-abx113566
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lysozyme C (LYZ) Antibody

20-abx006720
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lysozyme C (LYZ) Antibody

20-abx320472
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lysozyme C (LYZ) Antibody

20-abx339932
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lysozyme C (LYZ) Antibody

20-abx339933
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lysozyme C (LYZ) Antibody

20-abx301345
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human LYZ shRNA Plasmid

20-abx952758
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Lysozyme C (LYZ)

1-CSB-EP013283HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Lysozyme C(LYZ) expressed in E.coli

LYZ Antibody, HRP conjugated

1-CSB-PA02769B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYZ. Recognizes LYZ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LYZ Antibody, FITC conjugated

1-CSB-PA02769C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYZ. Recognizes LYZ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LYZ Antibody, Biotin conjugated

1-CSB-PA02769D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYZ. Recognizes LYZ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Lysozyme/LYZ Antibody

PB9663 100ug/vial
EUR 334

LYZ Recombinant Protein (Human)

RP018508 100 ug Ask for price

Polyclonal LYZ Antibody (C-term)

APR04635G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LYZ (C-term). This antibody is tested and proven to work in the following applications:

Lysozyme C (LYZ) Antibody (HRP)

20-abx306291
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lysozyme C (LYZ) Antibody (FITC)

20-abx306292
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lysozyme C (LYZ) Antibody (Biotin)

20-abx306293
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LYZ Polyclonal Antibody, HRP Conjugated

A50617 100 µg
EUR 570.55
Description: kits suitable for this type of research

LYZ Polyclonal Antibody, FITC Conjugated

A50618 100 µg
EUR 570.55
Description: fast delivery possible

LYZ Polyclonal Antibody, Biotin Conjugated

A50619 100 µg
EUR 570.55
Description: reagents widely cited

Lophura leucomelanos Lysozyme C (LYZ)

1-CSB-EP013283LIQ
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Lophura leucomelanos Lysozyme C(LYZ) expressed in E.coli

LYZ ORF Vector (Human) (pORF)

ORF006170 1.0 ug DNA
EUR 95

LYZ ELISA Kit (Human) (OKAN05567)

OKAN05567 96 Wells
EUR 792
Description: Description of target: This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-4]glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the antimicrobial agents found in human milk, and is also present in spleen, lung, kidney, white blood cells, plasma, saliva, and tears. The protein has antibacterial activity against a number of bacterial species. Missense mutations in this gene have been identified in heritable renal amyloidosis.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.277 ng/mL

LYZ ELISA Kit (Chicken) (OKAN06479)

OKAN06479 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.262 ng/mL

LYZ ELISA Kit (Chicken) (OKCD07199)

OKCD07199 96 Wells
EUR 1001
Description: Description of target: This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-4]glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the antimicrobial agents found in human milk, and is also present in spleen, lung, kidney, white blood cells, plasma, saliva, and tears. The protein has antibacterial activity against a number of bacterial species. Missense mutations in this gene have been identified in heritable renal amyloidosis.;Species reactivity: Chicken;Application: ELISA;Assay info: ;Sensitivity: < 0.262ng/mL

LYZ ELISA Kit (Human) (OKCD07200)

OKCD07200 96 Wells
EUR 936
Description: Description of target: LYZ is a human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta.glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the anti-microbial agents found in human milk, and is also present in spleen, lung, kidney, white blood cells, plasma, saliva, and tears. Missense mutations in LYZ have been identified in heritable renal amyloidosis.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.283ng/mL

LYZ ELISA Kit (Chicken) (OKEH03977)

OKEH03977 96 Wells
EUR 844
Description: Description of target: Lysozymes have primarily a bacteriolytic function; those in tissues and body fluids are associated with the monocyte-macrophage system and enhance the activity of immunoagents. Has bacteriolytic activity against M.luteus.;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.39 ng/mL

LYZ ELISA Kit (Bovine) (OKEH07781)

OKEH07781 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.1ng/mL

Chicken Lysozyme C (LYZ) ELISA Kit

abx515683-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human LYZ/ Lysozyme C ELISA Kit

E1523Hu 1 Kit
EUR 571

Chicken Lysozyme C, LYZ ELISA KIT

ELI-03934c 96 Tests
EUR 928

Human Lysozyme C, LYZ ELISA KIT

ELI-03935h 96 Tests
EUR 824

Rabbit Lysozyme C, LYZ ELISA KIT

ELI-03936Ra 96 Tests
EUR 928

Human Lysozyme C (LYZ) ELISA Kit

abx259050-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Lysozyme C (LYZ) ELISA Kit

abx250631-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

LYZ sgRNA CRISPR Lentivector set (Human)

K1249201 3 x 1.0 ug
EUR 339

Rat Lysozyme C(LYZ) ELISA kit

CSB-EL013283RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Rat Lysozyme C (LYZ) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Lysozyme C(LYZ) ELISA kit

1-CSB-EL013283RA
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Rat Lysozyme C(LYZ) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Chicken LYZ/ Lysozyme C ELISA Kit

E0051Ch 1 Kit
EUR 717

LYZ sgRNA CRISPR Lentivector (Human) (Target 1)

K1249202 1.0 ug DNA
EUR 154

LYZ sgRNA CRISPR Lentivector (Human) (Target 2)

K1249203 1.0 ug DNA
EUR 154

LYZ sgRNA CRISPR Lentivector (Human) (Target 3)

K1249204 1.0 ug DNA
EUR 154

Recombinant Human Lysozyme C/LYZ (C-6His)

CI91-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl,10% Glycerol,pH7.5.

Recombinant Human Lysozyme C/LYZ (C-6His)

CI91-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl,10% Glycerol,pH7.5.

Recombinant Human Lysozyme C/LYZ (C-6His)

CI91-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl,10% Glycerol,pH7.5.

Recombinant Human Lysozyme C/LYZ (C-6His)

CI91-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl,10% Glycerol,pH7.5.

ELISA kit for Human Lysozyme C (LYZ)

KTE61762-48T 48T
EUR 332
  • This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-5]glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the anti-microbial agents found in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lysozyme C (LYZ) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Lysozyme C (LYZ)

KTE61762-5platesof96wells 5 plates of 96 wells
EUR 2115
  • This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-5]glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the anti-microbial agents found in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lysozyme C (LYZ) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.