MAN1B1

MAN1B1 siRNA

20-abx903120
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAN1B1 siRNA

20-abx923373
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAN1B1 siRNA

20-abx923374
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAN1B1 antibody

70R-36085 100 ug
EUR 327.00
Description: Rabbit polyclonal MAN1B1 antibody

MAN1B1 antibody

70R-12941 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal MAN1B1 antibody

MAN1B1 Antibody

ABD13148 100 ug
EUR 438.00

MAN1B1 Antibody

ABD4043 100 ug
EUR 438.00

MAN1B1 Antibody

ABF0386 100 ug
EUR 438.00

MAN1B1 Antibody

1-CSB-PA006800
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MAN1B1. Recognizes MAN1B1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

MAN1B1 Antibody

CSB-PA217897-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MAN1B1. Recognizes MAN1B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MAN1B1 Antibody

CSB-PA217897-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MAN1B1. Recognizes MAN1B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MAN1B1 Antibody

34675-100ul 100ul
EUR 252.00

MAN1B1 Antibody

34675-50ul 50ul
EUR 187.00

MAN1B1 antibody

22044-100ul 100ul
EUR 390.00

MAN1B1 Antibody

AF0386 200ul
EUR 304.00
Description: MAN1B1 antibody detects endogenous levels of total MAN1B1.

MAN1B1 Polyclonal Antibody

ABP53625-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human MAN1B1 at AA rangle: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of MAN1B1 from Human. This MAN1B1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MAN1B1 at AA rangle: 100-180

MAN1B1 Polyclonal Antibody

ABP53625-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human MAN1B1 at AA rangle: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of MAN1B1 from Human. This MAN1B1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MAN1B1 at AA rangle: 100-180

MAN1B1 Polyclonal Antibody

ABP53625-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human MAN1B1 at AA rangle: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of MAN1B1 from Human. This MAN1B1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MAN1B1 at AA rangle: 100-180

MAN1B1 Rabbit pAb

A13784-100ul 100 ul
EUR 308.00

MAN1B1 Rabbit pAb

A13784-200ul 200 ul
EUR 459.00

MAN1B1 Rabbit pAb

A13784-20ul 20 ul
EUR 183.00

MAN1B1 Rabbit pAb

A13784-50ul 50 ul
EUR 223.00

MAN1B1 Polyclonal Antibody

E-AB-31966-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: This gene encodes an enzyme belonging to the glycosyl hydrolase 47 family. This enzyme funct
  • Show more
Description: Rabbit antibody against Human MAN1B1 for WB,ELISA applications.

MAN1B1 Polyclonal Antibody

E-AB-31966-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: This gene encodes an enzyme belonging to the glycosyl hydrolase 47 family. This enzyme funct
  • Show more
Description: Rabbit antibody against Human MAN1B1 for WB,ELISA applications.

MAN1B1 Polyclonal Antibody

E-AB-31966-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: This gene encodes an enzyme belonging to the glycosyl hydrolase 47 family. This enzyme funct
  • Show more
Description: Rabbit antibody against Human MAN1B1 for WB,ELISA applications.

MAN1B1 cloning plasmid

CSB-CL891727HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2100
  • Sequence: atggctgcctgcgagggcaggagaagcggagctctcggttcctctcagtcggacttcctgacgccgccagtgggcggggccccttgggccgtcgccaccactgtagtcatgtacccaccgccgccgccgccgcctcatcgggacttcatctcggtgacgctgagctttggcgaga
  • Show more
Description: A cloning plasmid for the MAN1B1 gene.

MAN1B1 cloning plasmid

CSB-CL891727HU2-10ug 10ug
EUR 474.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2100
  • Sequence: atggctgcctgcgagggcaggagaagcggagctctcggttcctctcagtcggacttcctgacgccgccagtgggcggggccccttgggccgtcgccaccactgtagtcatgtacccaccgccgccgccgccgcctcatcgggacttcatctcggtgacgctgagctttggcgaga
  • Show more
Description: A cloning plasmid for the MAN1B1 gene.

MAN1B1 Blocking Peptide

AF0386-BP 1mg
EUR 195.00

MAN1B1 Conjugated Antibody

C34675 100ul
EUR 397.00

MAN1B1 Polyclonal Antibody

ES4624-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against MAN1B1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MAN1B1 Polyclonal Antibody

ES4624-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against MAN1B1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

pENTR223-MAN1B1 vector

PVT11792 2 ug
EUR 304.00

Anti-MAN1B1 antibody

STJ115729 100 µl
EUR 277.00
Description: This gene encodes an enzyme belonging to the glycosyl hydrolase 47 family. This enzyme functions in N-glycan biosynthesis, and is a class I alpha-1,2-mannosidase that specifically converts Man9GlcNAc to Man8GlcNAc isomer B. It is required for N-glycan trimming to Man5-6GlcNAc2 in the endoplasmic-reticulum-associated degradation pathway. Mutations in this gene cause autosomal-recessive intellectual disability. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 11.

Anti-MAN1B1 antibody

STJ93998 200 µl
EUR 197.00
Description: Rabbit polyclonal to MAN1B1.

Anti-MAN1B1 (6B1)

YF-MA11357 100 ug
EUR 363.00
Description: Mouse monoclonal to MAN1B1

Human MAN1B1 shRNA Plasmid

20-abx957714
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MAN1B1 shRNA Plasmid

20-abx981567
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-MAN1B1/Ermani Antibody

A06537 100ul
EUR 397.00
Description: Rabbit Polyclonal MAN1B1/Ermani Antibody. Validated in WB and tested in Human, Mouse.

Rat MAN1B1 shRNA Plasmid

20-abx990923
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Man1b1 ELISA KIT

ELI-19646m 96 Tests
EUR 865.00

Human MAN1B1 ELISA KIT

ELI-43026h 96 Tests
EUR 824.00

MAN1B1 Recombinant Protein (Human)

RP018691 100 ug Ask for price

MAN1B1 Recombinant Protein (Human)

RP018694 100 ug Ask for price

MAN1B1 Recombinant Protein (Mouse)

RP149123 100 ug Ask for price

Man1b1 ORF Vector (Mouse) (pORF)

ORF049709 1.0 ug DNA
EUR 506.00

MAN1B1 ORF Vector (Human) (pORF)

ORF006231 1.0 ug DNA
EUR 95.00

MAN1B1 ORF Vector (Human) (pORF)

ORF006232 1.0 ug DNA
EUR 95.00

pECMV-Man1b1-m-FLAG Plasmid

PVT15268 2 ug
EUR 325.00

MAN1B1 sgRNA CRISPR Lentivector set (Human)

K1259701 3 x 1.0 ug
EUR 339.00

MAN1B1 Protein Vector (Human) (pPB-C-His)

PV024921 500 ng
EUR 329.00

MAN1B1 Protein Vector (Human) (pPB-N-His)

PV024922 500 ng
EUR 329.00

MAN1B1 Protein Vector (Human) (pPM-C-HA)

PV024923 500 ng
EUR 329.00

MAN1B1 Protein Vector (Human) (pPM-C-His)

PV024924 500 ng
EUR 329.00

MAN1B1 Protein Vector (Human) (pPB-C-His)

PV024925 500 ng
EUR 329.00

MAN1B1 Protein Vector (Human) (pPB-N-His)

PV024926 500 ng
EUR 329.00

MAN1B1 Protein Vector (Human) (pPM-C-HA)

PV024927 500 ng
EUR 329.00

MAN1B1 Protein Vector (Human) (pPM-C-His)

PV024928 500 ng
EUR 329.00

MAN1B1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1259702 1.0 ug DNA
EUR 154.00

MAN1B1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1259703 1.0 ug DNA
EUR 154.00

MAN1B1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1259704 1.0 ug DNA
EUR 154.00

MAN1B1 3'UTR Luciferase Stable Cell Line

TU012915 1.0 ml
EUR 1521.00

MAN1B1 3'UTR GFP Stable Cell Line

TU062915 1.0 ml
EUR 1521.00

MAN1B1 Protein Vector (Mouse) (pPB-C-His)

PV198834 500 ng
EUR 603.00

MAN1B1 Protein Vector (Mouse) (pPB-N-His)

PV198835 500 ng
EUR 603.00

MAN1B1 Protein Vector (Mouse) (pPM-C-HA)

PV198836 500 ng
EUR 603.00

MAN1B1 Protein Vector (Mouse) (pPM-C-His)

PV198837 500 ng
EUR 603.00

Man1b1 3'UTR GFP Stable Cell Line

TU262795 1.0 ml Ask for price

Man1b1 3'UTR Luciferase Stable Cell Line

TU212795 1.0 ml Ask for price

Mannosidase Alpha Class 1B Member 1 (MAN1B1) Antibody

abx331034-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Mannosidase Alpha Class 1B Member 1 (MAN1B1) Antibody

20-abx323413
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mannosidase Alpha Class 1B Member 1 (MAN1B1) Antibody

20-abx014460
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

MAN1B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV712131 1.0 ug DNA
EUR 316.00

MAN1B1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV712135 1.0 ug DNA
EUR 316.00

MAN1B1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV712136 1.0 ug DNA
EUR 316.00

Recombinant Human ER α-1,2-Mannosidase/MAN1B1 (C-6His)

C918-10ug 10ug
EUR 156.00
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCL,10mM reduced Glutathione,pH 8.0.

Recombinant Human ER α-1,2-Mannosidase/MAN1B1 (C-6His)

C918-1mg 1mg
EUR 2283.00
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCL,10mM reduced Glutathione,pH 8.0.

Recombinant Human ER α-1,2-Mannosidase/MAN1B1 (C-6His)

C918-500ug 500ug
EUR 1613.00
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCL,10mM reduced Glutathione,pH 8.0.

Recombinant Human ER α-1,2-Mannosidase/MAN1B1 (C-6His)

C918-50ug 50ug
EUR 369.00
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCL,10mM reduced Glutathione,pH 8.0.

MAN1B1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1259705 3 x 1.0 ug
EUR 376.00

MAN1B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1259706 1.0 ug DNA
EUR 167.00

MAN1B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1259707 1.0 ug DNA
EUR 167.00

MAN1B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1259708 1.0 ug DNA
EUR 167.00

MAN1B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV712132 1.0 ug DNA
EUR 316.00

MAN1B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV712133 1.0 ug DNA
EUR 374.00

MAN1B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV712134 1.0 ug DNA
EUR 374.00