MAN1B1

MAN1B1 siRNA
20-abx903120	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAN1B1 Antibody
AF0386	Affbiotech	200ul	EUR 304
Description: MAN1B1 antibody detects endogenous levels of total MAN1B1.

MAN1B1 Antibody
ABF0386	Lifescience Market	100 ug	EUR 438

MAN1B1 siRNA
20-abx923373	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAN1B1 siRNA
20-abx923374	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAN1B1 antibody
70R-36085	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal MAN1B1 antibody

MAN1B1 Antibody
ABD13148	Lifescience Market	100 ug	EUR 438

MAN1B1 Antibody
ABD4043	Lifescience Market	100 ug	EUR 438

MAN1B1 Antibody
34675-100ul	SAB	100ul	EUR 252

MAN1B1 Antibody
34675-50ul	SAB	50ul	EUR 187

MAN1B1 antibody
22044-100ul	SAB	100ul	EUR 390

MAN1B1 antibody
70R-12941	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal MAN1B1 antibody

MAN1B1 Antibody
1-CSB-PA006800	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MAN1B1. Recognizes MAN1B1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

MAN1B1 Antibody
CSB-PA217897-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against MAN1B1. Recognizes MAN1B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MAN1B1 Antibody
CSB-PA217897-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against MAN1B1. Recognizes MAN1B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MAN1B1 Conjugated Antibody
C34675	SAB	100ul	EUR 397

MAN1B1 Blocking Peptide
AF0386-BP	Affbiotech	1mg	EUR 195

MAN1B1 Polyclonal Antibody
ES4624-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MAN1B1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MAN1B1 Polyclonal Antibody
ES4624-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MAN1B1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MAN1B1 Polyclonal Antibody
ABP53625-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human MAN1B1 at AA rangle: 100-180 Applications tips:
Description: A polyclonal antibody for detection of MAN1B1 from Human. This MAN1B1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MAN1B1 at AA rangle: 100-180

MAN1B1 Polyclonal Antibody
ABP53625-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human MAN1B1 at AA rangle: 100-180 Applications tips:
Description: A polyclonal antibody for detection of MAN1B1 from Human. This MAN1B1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MAN1B1 at AA rangle: 100-180

MAN1B1 Polyclonal Antibody
ABP53625-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human MAN1B1 at AA rangle: 100-180 Applications tips:
Description: A polyclonal antibody for detection of MAN1B1 from Human. This MAN1B1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MAN1B1 at AA rangle: 100-180

MAN1B1 Rabbit pAb
A13784-100ul	Abclonal	100 ul	EUR 308

MAN1B1 Rabbit pAb
A13784-200ul	Abclonal	200 ul	EUR 459

MAN1B1 Rabbit pAb
A13784-20ul	Abclonal	20 ul	EUR 183

MAN1B1 Rabbit pAb
A13784-50ul	Abclonal	50 ul	EUR 223

MAN1B1 cloning plasmid
CSB-CL891727HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2100 Sequence: atggctgcctgcgagggcaggagaagcggagctctcggttcctctcagtcggacttcctgacgccgccagtgggcggggccccttgggccgtcgccaccactgtagtcatgtacccaccgccgccgccgccgcctcatcgggacttcatctcggtgacgctgagctttggcgaga Show more
Description: A cloning plasmid for the MAN1B1 gene.

MAN1B1 cloning plasmid
CSB-CL891727HU2-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2100 Sequence: atggctgcctgcgagggcaggagaagcggagctctcggttcctctcagtcggacttcctgacgccgccagtgggcggggccccttgggccgtcgccaccactgtagtcatgtacccaccgccgccgccgccgcctcatcgggacttcatctcggtgacgctgagctttggcgaga Show more
Description: A cloning plasmid for the MAN1B1 gene.

pENTR223-MAN1B1 vector
PVT11792	Lifescience Market	2 ug	EUR 304

Anti-MAN1B1 antibody
STJ93998	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to MAN1B1.

Anti-MAN1B1 antibody
STJ115729	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an enzyme belonging to the glycosyl hydrolase 47 family. This enzyme functions in N-glycan biosynthesis, and is a class I alpha-1,2-mannosidase that specifically converts Man9GlcNAc to Man8GlcNAc isomer B. It is required for N-glycan trimming to Man5-6GlcNAc2 in the endoplasmic-reticulum-associated degradation pathway. Mutations in this gene cause autosomal-recessive intellectual disability. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 11.

Anti-MAN1B1 (6B1)
YF-MA11357	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MAN1B1

Mouse Man1b1 ELISA KIT
ELI-19646m	Lifescience Market	96 Tests	EUR 865

Human MAN1B1 ELISA KIT
ELI-43026h	Lifescience Market	96 Tests	EUR 824

Human MAN1B1 shRNA Plasmid
20-abx957714	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-MAN1B1/Ermani Antibody
A06537	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal MAN1B1/Ermani Antibody. Validated in WB and tested in Human, Mouse.

Rat MAN1B1 shRNA Plasmid
20-abx990923	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MAN1B1 shRNA Plasmid
20-abx981567	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MAN1B1 Recombinant Protein (Human)
RP018691	ABM	100 ug	Ask for price

MAN1B1 Recombinant Protein (Human)
RP018694	ABM	100 ug	Ask for price

MAN1B1 Recombinant Protein (Mouse)
RP149123	ABM	100 ug	Ask for price

MAN1B1 ORF Vector (Human) (pORF)
ORF006231	ABM	1.0 ug DNA	EUR 95

MAN1B1 ORF Vector (Human) (pORF)
ORF006232	ABM	1.0 ug DNA	EUR 95

Man1b1 ORF Vector (Mouse) (pORF)
ORF049709	ABM	1.0 ug DNA	EUR 506

pECMV-Man1b1-m-FLAG Plasmid
PVT15268	Lifescience Market	2 ug	EUR 325

MAN1B1 sgRNA CRISPR Lentivector set (Human)
K1259701	ABM	3 x 1.0 ug	EUR 339

MAN1B1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1259702	ABM	1.0 ug DNA	EUR 154

MAN1B1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1259703	ABM	1.0 ug DNA	EUR 154

MAN1B1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1259704	ABM	1.0 ug DNA	EUR 154

MAN1B1 Protein Vector (Human) (pPB-C-His)
PV024921	ABM	500 ng	EUR 329

MAN1B1 Protein Vector (Human) (pPB-N-His)
PV024922	ABM	500 ng	EUR 329

MAN1B1 Protein Vector (Human) (pPM-C-HA)
PV024923	ABM	500 ng	EUR 329

MAN1B1 Protein Vector (Human) (pPM-C-His)
PV024924	ABM	500 ng	EUR 329

MAN1B1 Protein Vector (Human) (pPB-C-His)
PV024925	ABM	500 ng	EUR 329

MAN1B1 Protein Vector (Human) (pPB-N-His)
PV024926	ABM	500 ng	EUR 329

MAN1B1 Protein Vector (Human) (pPM-C-HA)
PV024927	ABM	500 ng	EUR 329

MAN1B1 Protein Vector (Human) (pPM-C-His)
PV024928	ABM	500 ng	EUR 329

MAN1B1 Protein Vector (Mouse) (pPB-C-His)
PV198834	ABM	500 ng	EUR 603

MAN1B1 Protein Vector (Mouse) (pPB-N-His)
PV198835	ABM	500 ng	EUR 603

MAN1B1 Protein Vector (Mouse) (pPM-C-HA)
PV198836	ABM	500 ng	EUR 603

MAN1B1 Protein Vector (Mouse) (pPM-C-His)
PV198837	ABM	500 ng	EUR 603

Man1b1 3'UTR Luciferase Stable Cell Line
TU212795	ABM	1.0 ml	Ask for price

MAN1B1 3'UTR Luciferase Stable Cell Line
TU012915	ABM	1.0 ml	EUR 1521

MAN1B1 3'UTR GFP Stable Cell Line
TU062915	ABM	1.0 ml	EUR 1521

Man1b1 3'UTR GFP Stable Cell Line
TU262795	ABM	1.0 ml	Ask for price

Mannosidase Alpha Class 1B Member 1 (MAN1B1) Antibody
20-abx014460	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Mannosidase Alpha Class 1B Member 1 (MAN1B1) Antibody
20-abx323413	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Mannosidase Alpha Class 1B Member 1 (MAN1B1) Antibody
abx331034-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

MAN1B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV712131	ABM	1.0 ug DNA	EUR 316

MAN1B1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV712135	ABM	1.0 ug DNA	EUR 316

MAN1B1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV712136	ABM	1.0 ug DNA	EUR 316

Recombinant Human ER α-1,2-Mannosidase/MAN1B1 (C-6His)
C918-10ug	Novoprotein	10ug	EUR 156
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCL,10mM reduced Glutathione,pH 8.0.

Recombinant Human ER α-1,2-Mannosidase/MAN1B1 (C-6His)
C918-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCL,10mM reduced Glutathione,pH 8.0.

Recombinant Human ER α-1,2-Mannosidase/MAN1B1 (C-6His)
C918-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCL,10mM reduced Glutathione,pH 8.0.

Recombinant Human ER α-1,2-Mannosidase/MAN1B1 (C-6His)
C918-50ug	Novoprotein	50ug	EUR 369
Description: Supplied as a 0.2 μm filtered solution of 50mM TrisHCL,10mM reduced Glutathione,pH 8.0.

MAN1B1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1259705	ABM	3 x 1.0 ug	EUR 376

MAN1B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1259706	ABM	1.0 ug DNA	EUR 167

MAN1B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1259707	ABM	1.0 ug DNA	EUR 167

MAN1B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1259708	ABM	1.0 ug DNA	EUR 167

MAN1B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV712132	ABM	1.0 ug DNA	EUR 316

MAN1B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV712133	ABM	1.0 ug DNA	EUR 374

MAN1B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV712134	ABM	1.0 ug DNA	EUR 374