MBD5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

MBD5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19831 100 ug
EUR 403
Description: Rabbit polyclonal to MBD5


YF-PA26365 50 ul
EUR 334
Description: Mouse polyclonal to MBD5

MBD5 Polyclonal Antibody

A-3729 150 µl
EUR 1005.55
Description: reagents widely cited

MBD5 cloning plasmid

CSB-CL868388HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 690
  • Sequence: atgttccctcctactgccaacatgcttctcccaacaggtgaagggcaaagtggtcgagcagcactaagagataagctgatgtctcagcaaaaagacgcattgcggaaaagaaaacaaccacctacgacagtgttgagtttgctcagacagtctcaaatggatagttctgcagttcc
  • Show more
Description: A cloning plasmid for the MBD5 gene.

MBD5 Polyclonal Antibody

A67422 100 µg
EUR 570.55
Description: fast delivery possible

anti- MBD5 antibody

FNab05037 100µg
EUR 548.75
  • Immunogen: methyl-CpG binding domain protein 5
  • Uniprot ID: Q9P267
  • Gene ID: 55777
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against MBD5

Anti-MBD5 antibody

PAab05037 100 ug
EUR 386

MBD5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MBD5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MBD5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF010858 96 Tests
EUR 689

Human MBD5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-MBD5 (4A12-1B6)

YF-MA18831 100 ug
EUR 363
Description: Mouse monoclonal to MBD5

MBD5 Polyclonal Antibody, HRP Conjugated

A67423 100 µg
EUR 570.55
Description: reagents widely cited

MBD5 Polyclonal Antibody, FITC Conjugated

A67424 100 µg
EUR 570.55
Description: Ask the seller for details

MBD5 Polyclonal Antibody, Biotin Conjugated

A67425 100 µg
EUR 570.55
Description: The best epigenetics products

MBD5 ORF Vector (Human) (pORF)

ORF006304 1.0 ug DNA
EUR 95

Mbd5 ORF Vector (Mouse) (pORF)

ORF049885 1.0 ug DNA
EUR 1572

MBD5 sgRNA CRISPR Lentivector set (Human)

K1274701 3 x 1.0 ug
EUR 339

Mbd5 sgRNA CRISPR Lentivector set (Mouse)

K3345701 3 x 1.0 ug
EUR 339

MBD5 sgRNA CRISPR Lentivector (Human) (Target 1)

K1274702 1.0 ug DNA
EUR 154

MBD5 sgRNA CRISPR Lentivector (Human) (Target 2)

K1274703 1.0 ug DNA
EUR 154

MBD5 sgRNA CRISPR Lentivector (Human) (Target 3)

K1274704 1.0 ug DNA
EUR 154

Mbd5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3345702 1.0 ug DNA
EUR 154

Mbd5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3345703 1.0 ug DNA
EUR 154

Mbd5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3345704 1.0 ug DNA
EUR 154

MBD5 Protein Vector (Human) (pPB-C-His)

PV025213 500 ng
EUR 329

MBD5 Protein Vector (Human) (pPB-N-His)

PV025214 500 ng
EUR 329

MBD5 Protein Vector (Human) (pPM-C-HA)

PV025215 500 ng
EUR 329

MBD5 Protein Vector (Human) (pPM-C-His)

PV025216 500 ng
EUR 329

MBD5 Protein Vector (Mouse) (pPB-C-His)

PV199538 500 ng
EUR 2885

MBD5 Protein Vector (Mouse) (pPB-N-His)

PV199539 500 ng
EUR 2885

MBD5 Protein Vector (Mouse) (pPM-C-HA)

PV199540 500 ng
EUR 2885

MBD5 Protein Vector (Mouse) (pPM-C-His)

PV199541 500 ng
EUR 2885

Mbd5 3'UTR Luciferase Stable Cell Line

TU112958 1.0 ml Ask for price

Mbd5 3'UTR GFP Stable Cell Line

TU162958 1.0 ml Ask for price

MBD5 3'UTR GFP Stable Cell Line

TU063066 1.0 ml
EUR 4617

MBD5 3'UTR Luciferase Stable Cell Line

TU013066 1.0 ml
EUR 4617

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody

abx235037-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Methyl- CpG- binding domain protein 5, MBD5 ELISA KIT

ELI-23704h 96 Tests
EUR 824

Mouse Methyl- CpG- binding domain protein 5, Mbd5 ELISA KIT

ELI-46065m 96 Tests
EUR 865

Human Methyl-CpG Binding Domain Protein 5 (MBD5) ELISA Kit

abx388445-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

MBD5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1274705 3 x 1.0 ug
EUR 376

Mbd5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3345705 3 x 1.0 ug
EUR 376

MBD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1274706 1.0 ug DNA
EUR 167

MBD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1274707 1.0 ug DNA
EUR 167

MBD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1274708 1.0 ug DNA
EUR 167

Mbd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3345706 1.0 ug DNA
EUR 167

Mbd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3345707 1.0 ug DNA
EUR 167

Mbd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3345708 1.0 ug DNA
EUR 167