MBD5

MBD5 antibody
70R-18430 50 ul
EUR 435.00
Description: Rabbit polyclonal MBD5 antibody

MBD5 Antibody
1-CSB-PA868388LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

MBD5 Antibody
1-CSB-PA013536GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-MBD5
YF-PA19831 100 ug
EUR 403.00
Description: Rabbit polyclonal to MBD5

anti-MBD5
YF-PA26365 50 ul
EUR 334.00
Description: Mouse polyclonal to MBD5

MBD5 Polyclonal Antibody
A-3729 150 µl
EUR 1005.55
Description: reagents widely cited

MBD5 Polyclonal Antibody
A67422 100 µg
EUR 570.55
Description: fast delivery possible

MBD5 cloning plasmid
CSB-CL868388HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 690
  • Sequence: atgttccctcctactgccaacatgcttctcccaacaggtgaagggcaaagtggtcgagcagcactaagagataagctgatgtctcagcaaaaagacgcattgcggaaaagaaaacaaccacctacgacagtgttgagtttgctcagacagtctcaaatggatagttctgcagttcc
  • Show more
Description: A cloning plasmid for the MBD5 gene.

Anti-MBD5 antibody
PAab05037 100 ug
EUR 386.00

anti- MBD5 antibody
FNab05037 100µg
EUR 548.75
  • Immunogen: methyl-CpG binding domain protein 5
  • Uniprot ID: Q9P267
  • Gene ID: 55777
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against MBD5

Human MBD5 shRNA Plasmid
20-abx960911
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MBD5 Antibody, HRP conjugated
1-CSB-PA868388LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MBD5 Antibody, FITC conjugated
1-CSB-PA868388LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MBD5 Antibody, Biotin conjugated
1-CSB-PA868388LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MBD5 ELISA KIT|Human
EF010858 96 Tests
EUR 689.00

Anti-MBD5 (4A12-1B6)
YF-MA18831 100 ug
EUR 363.00
Description: Mouse monoclonal to MBD5

MBD5 Polyclonal Antibody, HRP Conjugated
A67423 100 µg
EUR 570.55
Description: reagents widely cited

MBD5 Polyclonal Antibody, FITC Conjugated
A67424 100 µg
EUR 570.55
Description: Ask the seller for details

MBD5 Polyclonal Antibody, Biotin Conjugated
A67425 100 µg
EUR 570.55
Description: The best epigenetics products

Mbd5 ORF Vector (Mouse) (pORF)
ORF049885 1.0 ug DNA
EUR 1572.00

MBD5 ORF Vector (Human) (pORF)
ORF006304 1.0 ug DNA
EUR 95.00

MBD5 sgRNA CRISPR Lentivector set (Human)
K1274701 3 x 1.0 ug
EUR 339.00

Mbd5 sgRNA CRISPR Lentivector set (Mouse)
K3345701 3 x 1.0 ug
EUR 339.00

MBD5 Protein Vector (Human) (pPB-C-His)
PV025213 500 ng
EUR 329.00

MBD5 Protein Vector (Human) (pPB-N-His)
PV025214 500 ng
EUR 329.00

MBD5 Protein Vector (Human) (pPM-C-HA)
PV025215 500 ng
EUR 329.00

MBD5 Protein Vector (Human) (pPM-C-His)
PV025216 500 ng
EUR 329.00

MBD5 sgRNA CRISPR Lentivector (Human) (Target 1)
K1274702 1.0 ug DNA
EUR 154.00

MBD5 sgRNA CRISPR Lentivector (Human) (Target 2)
K1274703 1.0 ug DNA
EUR 154.00

MBD5 sgRNA CRISPR Lentivector (Human) (Target 3)
K1274704 1.0 ug DNA
EUR 154.00

Mbd5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3345702 1.0 ug DNA
EUR 154.00

Mbd5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3345703 1.0 ug DNA
EUR 154.00

Mbd5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3345704 1.0 ug DNA
EUR 154.00

MBD5 3'UTR Luciferase Stable Cell Line
TU013066 1.0 ml
EUR 4617.00

MBD5 3'UTR GFP Stable Cell Line
TU063066 1.0 ml
EUR 4617.00

MBD5 Protein Vector (Mouse) (pPB-C-His)
PV199538 500 ng
EUR 2885.00

MBD5 Protein Vector (Mouse) (pPB-N-His)
PV199539 500 ng
EUR 2885.00

MBD5 Protein Vector (Mouse) (pPM-C-HA)
PV199540 500 ng
EUR 2885.00

MBD5 Protein Vector (Mouse) (pPM-C-His)
PV199541 500 ng
EUR 2885.00

Mbd5 3'UTR GFP Stable Cell Line
TU162958 1.0 ml Ask for price

Mbd5 3'UTR Luciferase Stable Cell Line
TU112958 1.0 ml Ask for price

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody
abx235037-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody
20-abx311066
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody
20-abx116860
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody (HRP)
20-abx311067
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody (FITC)
20-abx311068
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody (Biotin)
20-abx311069
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Methyl-CpG Binding Domain Protein 5 (MBD5) ELISA Kit
abx388445-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

MBD5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1274705 3 x 1.0 ug
EUR 376.00

Mouse Methyl- CpG- binding domain protein 5, Mbd5 ELISA KIT
ELI-46065m 96 Tests
EUR 865.00

Human Methyl- CpG- binding domain protein 5, MBD5 ELISA KIT
ELI-23704h 96 Tests
EUR 824.00

Mbd5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3345705 3 x 1.0 ug
EUR 376.00

MBD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1274706 1.0 ug DNA
EUR 167.00

MBD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1274707 1.0 ug DNA
EUR 167.00

MBD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1274708 1.0 ug DNA
EUR 167.00

Mbd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3345706 1.0 ug DNA
EUR 167.00

Mbd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3345707 1.0 ug DNA
EUR 167.00

Mbd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3345708 1.0 ug DNA
EUR 167.00