MBD5

MBD5 Antibody
1-CSB-PA868388LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

MBD5 Antibody
1-CSB-PA013536GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MBD5 siRNA
20-abx923654	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-MBD5
YF-PA19831	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to MBD5

anti-MBD5
YF-PA26365	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to MBD5

MBD5 Polyclonal Antibody
A-3729	EpiGentek	150 µl	EUR 1005.55
Description: reagents widely cited

MBD5 cloning plasmid
CSB-CL868388HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 690 Sequence: atgttccctcctactgccaacatgcttctcccaacaggtgaagggcaaagtggtcgagcagcactaagagataagctgatgtctcagcaaaaagacgcattgcggaaaagaaaacaaccacctacgacagtgttgagtttgctcagacagtctcaaatggatagttctgcagttcc Show more
Description: A cloning plasmid for the MBD5 gene.

MBD5 Polyclonal Antibody
A67422	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

anti- MBD5 antibody
FNab05037	FN Test	100µg	EUR 548.75
Immunogen: methyl-CpG binding domain protein 5 Uniprot ID: Q9P267 Gene ID: 55777 Research Area: Metabolism, Developmental biology
Description: Antibody raised against MBD5

Anti-MBD5 antibody
PAab05037	Lifescience Market	100 ug	EUR 386

MBD5 Antibody, HRP conjugated
1-CSB-PA868388LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MBD5 Antibody, FITC conjugated
1-CSB-PA868388LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MBD5 Antibody, Biotin conjugated
1-CSB-PA868388LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBD5. Recognizes MBD5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MBD5 ELISA KIT|Human
EF010858	Lifescience Market	96 Tests	EUR 689

Human MBD5 shRNA Plasmid
20-abx960911	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-MBD5 (4A12-1B6)
YF-MA18831	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MBD5

MBD5 Polyclonal Antibody, HRP Conjugated
A67423	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

MBD5 Polyclonal Antibody, FITC Conjugated
A67424	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

MBD5 Polyclonal Antibody, Biotin Conjugated
A67425	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

MBD5 ORF Vector (Human) (pORF)
ORF006304	ABM	1.0 ug DNA	EUR 95

Mbd5 ORF Vector (Mouse) (pORF)
ORF049885	ABM	1.0 ug DNA	EUR 1572

MBD5 sgRNA CRISPR Lentivector set (Human)
K1274701	ABM	3 x 1.0 ug	EUR 339

Mbd5 sgRNA CRISPR Lentivector set (Mouse)
K3345701	ABM	3 x 1.0 ug	EUR 339

MBD5 sgRNA CRISPR Lentivector (Human) (Target 1)
K1274702	ABM	1.0 ug DNA	EUR 154

MBD5 sgRNA CRISPR Lentivector (Human) (Target 2)
K1274703	ABM	1.0 ug DNA	EUR 154

MBD5 sgRNA CRISPR Lentivector (Human) (Target 3)
K1274704	ABM	1.0 ug DNA	EUR 154

Mbd5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3345702	ABM	1.0 ug DNA	EUR 154

Mbd5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3345703	ABM	1.0 ug DNA	EUR 154

Mbd5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3345704	ABM	1.0 ug DNA	EUR 154

MBD5 Protein Vector (Human) (pPB-C-His)
PV025213	ABM	500 ng	EUR 329

MBD5 Protein Vector (Human) (pPB-N-His)
PV025214	ABM	500 ng	EUR 329

MBD5 Protein Vector (Human) (pPM-C-HA)
PV025215	ABM	500 ng	EUR 329

MBD5 Protein Vector (Human) (pPM-C-His)
PV025216	ABM	500 ng	EUR 329

MBD5 Protein Vector (Mouse) (pPB-C-His)
PV199538	ABM	500 ng	EUR 2885

MBD5 Protein Vector (Mouse) (pPB-N-His)
PV199539	ABM	500 ng	EUR 2885

MBD5 Protein Vector (Mouse) (pPM-C-HA)
PV199540	ABM	500 ng	EUR 2885

MBD5 Protein Vector (Mouse) (pPM-C-His)
PV199541	ABM	500 ng	EUR 2885

Mbd5 3'UTR Luciferase Stable Cell Line
TU112958	ABM	1.0 ml	Ask for price

Mbd5 3'UTR GFP Stable Cell Line
TU162958	ABM	1.0 ml	Ask for price

MBD5 3'UTR GFP Stable Cell Line
TU063066	ABM	1.0 ml	EUR 4617

MBD5 3'UTR Luciferase Stable Cell Line
TU013066	ABM	1.0 ml	EUR 4617

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody
20-abx116860	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody
abx235037-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody
20-abx311066	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody (HRP)
20-abx311067	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody (FITC)
20-abx311068	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Methyl-CpG Binding Domain Protein 5 (MBD5) Antibody (Biotin)
20-abx311069	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Methyl- CpG- binding domain protein 5, MBD5 ELISA KIT
ELI-23704h	Lifescience Market	96 Tests	EUR 824

Mouse Methyl- CpG- binding domain protein 5, Mbd5 ELISA KIT
ELI-46065m	Lifescience Market	96 Tests	EUR 865

Human Methyl-CpG Binding Domain Protein 5 (MBD5) ELISA Kit
abx388445-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

MBD5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1274705	ABM	3 x 1.0 ug	EUR 376

Mbd5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3345705	ABM	3 x 1.0 ug	EUR 376

MBD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1274706	ABM	1.0 ug DNA	EUR 167

MBD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1274707	ABM	1.0 ug DNA	EUR 167

MBD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1274708	ABM	1.0 ug DNA	EUR 167

Mbd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3345706	ABM	1.0 ug DNA	EUR 167

Mbd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3345707	ABM	1.0 ug DNA	EUR 167

Mbd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3345708	ABM	1.0 ug DNA	EUR 167