MDM4

Protein Mdm4 (MDM4) Antibody

abx027649-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein Mdm4 (MDM4) Antibody

abx015925-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Protein Mdm4 (MDM4) Antibody

20-abx216772
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Mdm4 (MDM4) Antibody

20-abx328735
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Mdm4 (MDM4) Antibody

20-abx318039
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mdm4/ Rat Mdm4 ELISA Kit

ELI-20468r 96 Tests
EUR 886

Protein Mdm4 (MDM4) Antibody (HRP)

20-abx314871
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Mdm4 (MDM4) Antibody (FITC)

20-abx314872
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Mdm4 (MDM4) Antibody (Biotin)

20-abx314873
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Mdm4 (MDM4) ELISA Kit

abx595374-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human Protein Mdm4, MDM4 ELISA KIT

ELI-16347h 96 Tests
EUR 824

Bovine Protein Mdm4, MDM4 ELISA KIT

ELI-37131b 96 Tests
EUR 928

MDM4 antibody

20R-1306 100 ug
EUR 377
Description: Rabbit polyclonal MDM4 antibody

MDM4 antibody

70R-18454 50 ul
EUR 435
Description: Rabbit polyclonal MDM4 antibody

MDM4 antibody

70R-10492 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MDM4 antibody

MDM4 antibody

10R-1842 100 ul
EUR 403
Description: Mouse monoclonal MDM4 antibody

MDM4 Antibody

45055-100ul 100ul
EUR 252

MDM4 Antibody

45055-50ul 50ul
EUR 187

MDM4 Antibody

DF7532 200ul
EUR 304
Description: MDM4 Antibody detects endogenous levels of total MDM4.

MDM4 antibody

70R-34534 100 ug
EUR 327
Description: Rabbit polyclonal MDM4 antibody

MDM4 Antibody

1-CSB-PA013627GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MDM4. Recognizes MDM4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MDM4 Antibody

1-CSB-PA013627LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MDM4. Recognizes MDM4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

MDM4 Antibody

1-CSB-PA010135
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MDM4. Recognizes MDM4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

MDM4 siRNA

20-abx903201
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MDM4 siRNA

20-abx923803
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MDM4 siRNA

20-abx923804
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MDM4 Antibody

AF7609 200ul
EUR 376
Description: MDM4 Antibody detects endogenous levels of MDM4.

MDM4 Antibody

AF7610 200ul
EUR 376
Description: MDM4 Antibody detects endogenous levels of MDM4.

MDM4 Antibody

ABD7532 100 ug
EUR 438

ELISA kit for Rat Protein Mdm4 (MDM4)

KTE100642-48T 48T
EUR 332
  • MDM4 encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhib
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein Mdm4 (MDM4)

KTE100642-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MDM4 encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhib
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein Mdm4 (MDM4)

KTE100642-96T 96T
EUR 539
  • MDM4 encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhib
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Protein Mdm4 (MDM4)

KTE10313-48T 48T
EUR 354
  • Protein Mdm4 (MDM4) gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppress
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Protein Mdm4 (MDM4)

KTE10313-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Protein Mdm4 (MDM4) gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppress
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Protein Mdm4 (MDM4)

KTE10313-96T 96T
EUR 572
  • Protein Mdm4 (MDM4) gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppress
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein Mdm4 (MDM4)

KTE71080-48T 48T
EUR 332
  • Mdm4 encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of Md
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein Mdm4 (MDM4)

KTE71080-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Mdm4 encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of Md
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein Mdm4 (MDM4)

KTE71080-96T 96T
EUR 539
  • Mdm4 encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of Md
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein Mdm4 (MDM4)

KTE61675-48T 48T
EUR 332
  • MDM4 encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhib
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein Mdm4 (MDM4)

KTE61675-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MDM4 encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhib
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein Mdm4 (MDM4)

KTE61675-96T 96T
EUR 539
  • MDM4 encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhib
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MDM4 Blocking Peptide

33R-4100 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MDM4 antibody, catalog no. 70R-10492

MDM4 Blocking Peptide

33R-6211 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MDM4 antibody, catalog no. 20R-1306

HdmX/MDM4 Antibody

3762-100
EUR 338

MDM4 Antibofy Antibody

39704-100ul 100ul
EUR 390

MDM4 Blocking Peptide

DF7532-BP 1mg
EUR 195

MDM4 antibody (Ser367)

70R-34533 100 ug
EUR 327
Description: Rabbit polyclonal MDM4 antibody (Ser367)

MDM4 Conjugated Antibody

C45055 100ul
EUR 397

MDM4 Blocking Peptide

AF7609-BP 1mg
EUR 195

MDM4 Blocking Peptide

AF7610-BP 1mg
EUR 195

MDM4 cloning plasmid

CSB-CL013627HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1473
  • Sequence: atgacatcattttccacctctgctcagtgttcaacatctgacagtgcttgcaggatctctcctggacaaatcaatcaggtacgaccaaaactgccgcttttgaagattttgcatgcagcaggtgcgcaaggtgaaatgttcactgttaaagaggtcatgcactatttaggtcagt
  • Show more
Description: A cloning plasmid for the MDM4 gene.

MDM4 Rabbit pAb

A1747-100ul 100 ul
EUR 308

MDM4 Rabbit pAb

A1747-200ul 200 ul
EUR 459

MDM4 Rabbit pAb

A1747-20ul 20 ul Ask for price

MDM4 Rabbit pAb

A1747-50ul 50 ul Ask for price

anti-MDM4 (2D10F4)

LF-MA30202 100 ul
EUR 486
Description: Mouse Monoclonal to MDM4

Anti-MDM4 antibody

STJ111111 100 µl
EUR 277
Description: This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhibit its activity, and have been shown to be overexpressed in a variety of human cancers. However, unlike MDM2 which degrades p53, this protein inhibits p53 by binding its transcriptional activation domain. This protein also interacts with MDM2 protein via the RING finger domain, and inhibits the latter's degradation. So this protein can reverse MDM2-targeted degradation of p53, while maintaining suppression of p53 transactivation and apoptotic functions. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

MDM4 (Phospho-Ser367) Antibody

12141-100ul 100ul
EUR 252

MDM4 (Phospho-Ser367) Antibody

12141-50ul 50ul
EUR 187

MDM4 (Phospho-Ser342) Antibody

12973-100ul 100ul
EUR 252

MDM4 (Phospho-Ser342) Antibody

12973-50ul 50ul
EUR 187

Phospho-MDM4 (Ser367) Antibody

CSB-PA975669-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-MDM4 (Ser367). Recognizes Phospho-MDM4 (Ser367) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-MDM4 (Ser367) Antibody

CSB-PA975669-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-MDM4 (Ser367). Recognizes Phospho-MDM4 (Ser367) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Protein MDMX (MDM4) Antibody

20-abx113634
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein MDMX (MDM4) Antibody

20-abx123850
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Protein MDMX (MDM4) Antibody

abx037030-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Rat MDM4 shRNA Plasmid

20-abx989289
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-MDM4 (Ser367) Antibody

AF7109 200ul
EUR 376
Description: Phospho-MDM4 (Ser367) Antibody detects endogenous levels of MDM4 only when phosphorylated at Ser367.

Phospho-MDM4 (Ser342) Antibody

AF7110 200ul
EUR 376
Description: Phospho-MDM4 (Ser342) Antibody detects endogenous levels of MDM4 only when phosphorylated at Ser342.

Polyclonal MDM4 Antibody (Center)

APR08404G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MDM4 (Center). This antibody is tested and proven to work in the following applications:

Phospho-MDM4 (S367) Antibody

1-CSB-PA010531
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-MDM4 (S367). Recognizes Phospho-MDM4 (S367) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

MDM4 Antibody, HRP conjugated

1-CSB-PA013627LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MDM4. Recognizes MDM4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MDM4 Antibody, FITC conjugated

1-CSB-PA013627LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MDM4. Recognizes MDM4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MDM4 Antibody, Biotin conjugated

1-CSB-PA013627LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MDM4. Recognizes MDM4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal HdmX/MDM4 Antibody

AMM05324G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HdmX/MDM4 . This antibody is tested and proven to work in the following applications:

Human MDM4 shRNA Plasmid

20-abx952854
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MDM4 shRNA Plasmid

20-abx971478
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-MDMX/MDM4 Antibody

PB9872 100ug/vial
EUR 334

pCMV-SPORT6.1-MDM4 Plasmid

PVT16017 2 ug
EUR 325

MDM4 Recombinant Protein (Human)

RP019054 100 ug Ask for price

MDM4 Recombinant Protein (Mouse)

RP149954 100 ug Ask for price

MDM4 Recombinant Protein (Rat)

RP211220 100 ug Ask for price

Phospho-MDM4 (Ser367) Blocking Peptide

AF7109-BP 1mg
EUR 195

Phospho-MDM4 (Ser342) Blocking Peptide

AF7110-BP 1mg
EUR 195

Monoclonal MDM4 Antibody, Clone: 2D10F4

AMM02677G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human MDM4. The antibodies are raised in Mouse and are from clone 2D10F4. This antibody is applicable in WB and IHC, ICC, E

Mdm4 ORF Vector (Rat) (pORF)

ORF070408 1.0 ug DNA
EUR 506

MDM4 ORF Vector (Human) (pORF)

ORF006352 1.0 ug DNA
EUR 95

Mdm4 ORF Vector (Mouse) (pORF)

ORF049986 1.0 ug DNA
EUR 506

pET28a-MDM4(1-137aa) Plasmid

PVTB00979-1a 2 ug
EUR 356

MDM4 ELISA Kit (Human) (OKEH07886)

OKEH07886 96 Wells
EUR 896
Description: Description of target: This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhibit its activity, and have been shown to be overexpressed in a variety of human cancers. However, unlike MDM2 which degrades p53, this protein inhibits p53 by binding its transcriptional activation domain. This protein also interacts with MDM2 protein via the RING finger domain, and inhibits the latter's degradation. So this protein can reverse MDM2-targeted degradation of p53, while maintaining suppression of p53 transactivation and apoptotic functions. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.44ng/mL

Human Protein MDMX (MDM4) ELISA Kit

abx259687-96tests 96 tests
EUR 911
  • Shipped within 20 working days.

MDM4 Colorimetric Cell-Based ELISA Kit

EKC1358 100ul
EUR 572

MDM4 (Phospho-Ser367) Polyclonal Conjugated Antibody

C12141 100ul
EUR 397

MDM4 (Phospho-Ser342) Polyclonal Conjugated Antibody

C12973 100ul
EUR 397

Polyclonal MDM4 antibody - N-terminal region

APR08405G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MDM4 - N-terminal region. This antibody is tested and proven to work in the following applications: