MDM4

Protein Mdm4 (MDM4) Antibody
abx027649-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Protein Mdm4 (MDM4) Antibody
abx027649-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Protein Mdm4 (MDM4) Antibody
20-abx328735	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Protein Mdm4 (MDM4) Antibody
20-abx216772	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Protein Mdm4 (MDM4) Antibody
20-abx318039	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Mdm4 (MDM4) ELISA Kit
abx595374-96tests	Abbexa	96 tests	EUR 637.00
Shipped within 1-2 weeks.

Protein Mdm4 (MDM4) Antibody (HRP)
20-abx314871	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Mdm4 (MDM4) Antibody (FITC)
20-abx314872	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Mdm4 (MDM4) Antibody (Biotin)
20-abx314873	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mdm4/ Rat Mdm4 ELISA Kit
ELI-20468r	Lifescience Market	96 Tests	EUR 886.00

Bovine Protein Mdm4, MDM4 ELISA KIT
ELI-37131b	Lifescience Market	96 Tests	EUR 928.00

Human Protein Mdm4, MDM4 ELISA KIT
ELI-16347h	Lifescience Market	96 Tests	EUR 824.00

MDM4 Antibody
AF7609	Affbiotech	200ul	EUR 376.00
Description: MDM4 Antibody detects endogenous levels of MDM4.

MDM4 Antibody
AF7610	Affbiotech	200ul	EUR 376.00
Description: MDM4 Antibody detects endogenous levels of MDM4.

MDM4 Antibody
1-CSB-PA013627GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MDM4. Recognizes MDM4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MDM4 Antibody
1-CSB-PA013627LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MDM4. Recognizes MDM4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

MDM4 Antibody
1-CSB-PA010135	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MDM4. Recognizes MDM4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

MDM4 antibody
20R-1306	Fitzgerald	100 ug	EUR 377.00
Description: Rabbit polyclonal MDM4 antibody

MDM4 antibody
10R-1842	Fitzgerald	100 ul	EUR 403.00
Description: Mouse monoclonal MDM4 antibody

MDM4 Antibody
45055-100ul	SAB	100ul	EUR 252.00

MDM4 Antibody
45055-50ul	SAB	50ul	EUR 187.00

MDM4 antibody
70R-34534	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal MDM4 antibody

MDM4 antibody
70R-18454	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal MDM4 antibody

MDM4 siRNA
20-abx903201	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MDM4 siRNA
20-abx923803	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MDM4 siRNA
20-abx923804	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MDM4 Antibody
DF7532	Affbiotech	200ul	EUR 304.00
Description: MDM4 Antibody detects endogenous levels of total MDM4.

MDM4 Antibody
ABD7532	Lifescience Market	100 ug	EUR 438.00

MDM4 antibody
70R-10492	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal MDM4 antibody

ELISA kit for Rat Protein Mdm4 (MDM4)
KTE100642-48T	Abbkine	48T	EUR 332.00
MDM4 encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhib Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein Mdm4 (MDM4)
KTE100642-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115.00
MDM4 encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhib Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein Mdm4 (MDM4)
KTE100642-96T	Abbkine	96T	EUR 539.00
MDM4 encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhib Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Protein Mdm4 (MDM4)
KTE10313-48T	Abbkine	48T	EUR 354.00
Protein Mdm4 (MDM4) gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppress Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Protein Mdm4 (MDM4)
KTE10313-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252.00
Protein Mdm4 (MDM4) gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppress Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Protein Mdm4 (MDM4)
KTE10313-96T	Abbkine	96T	EUR 572.00
Protein Mdm4 (MDM4) gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppress Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein Mdm4 (MDM4)
KTE61675-48T	Abbkine	48T	EUR 332.00
MDM4 encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhib Show more
Description: Quantitative sandwich ELISA for measuring Human Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein Mdm4 (MDM4)
KTE61675-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115.00
MDM4 encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhib Show more
Description: Quantitative sandwich ELISA for measuring Human Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein Mdm4 (MDM4)
KTE61675-96T	Abbkine	96T	EUR 539.00
MDM4 encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhib Show more
Description: Quantitative sandwich ELISA for measuring Human Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein Mdm4 (MDM4)
KTE71080-48T	Abbkine	48T	EUR 332.00
Mdm4 encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of Md Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein Mdm4 (MDM4)
KTE71080-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115.00
Mdm4 encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of Md Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein Mdm4 (MDM4)
KTE71080-96T	Abbkine	96T	EUR 539.00
Mdm4 encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of Md Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein Mdm4 (MDM4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MDM4 Blocking Peptide
AF7609-BP	Affbiotech	1mg	EUR 195.00

MDM4 Blocking Peptide
AF7610-BP	Affbiotech	1mg	EUR 195.00

MDM4 Conjugated Antibody
C45055	SAB	100ul	EUR 397.00

MDM4 cloning plasmid
CSB-CL013627HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1473 Sequence: atgacatcattttccacctctgctcagtgttcaacatctgacagtgcttgcaggatctctcctggacaaatcaatcaggtacgaccaaaactgccgcttttgaagattttgcatgcagcaggtgcgcaaggtgaaatgttcactgttaaagaggtcatgcactatttaggtcagt Show more
Description: A cloning plasmid for the MDM4 gene.

MDM4 Blocking Peptide
33R-4100	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MDM4 antibody, catalog no. 70R-10492

MDM4 Blocking Peptide
33R-6211	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MDM4 antibody, catalog no. 20R-1306

MDM4 Antibofy Antibody
39704-100ul	SAB	100ul	EUR 390.00

HdmX/MDM4 Antibody
3762-100	Biovision		EUR 338.00

MDM4 antibody (Ser367)
70R-34533	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal MDM4 antibody (Ser367)

MDM4 Blocking Peptide
DF7532-BP	Affbiotech	1mg	EUR 195.00

MDM4 Rabbit pAb
A1747-100ul	Abclonal	100 ul	EUR 308.00

MDM4 Rabbit pAb
A1747-200ul	Abclonal	200 ul	EUR 459.00

MDM4 Rabbit pAb
A1747-20ul	Abclonal	20 ul	Ask for price

MDM4 Rabbit pAb
A1747-50ul	Abclonal	50 ul	Ask for price

MDM4 Polyclonal Antibody
E-AB-31996-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and Show more
Description: Rabbit antibody against Human,Mouse,Rat MDM4 for WB,IHC-p,ELISA applications.

MDM4 Polyclonal Antibody
E-AB-31996-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and Show more
Description: Rabbit antibody against Human,Mouse,Rat MDM4 for WB,IHC-p,ELISA applications.

MDM4 Polyclonal Antibody
E-AB-31996-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and Show more
Description: Rabbit antibody against Human,Mouse,Rat MDM4 for WB,IHC-p,ELISA applications.

anti-MDM4 (2D10F4)
LF-MA30202	Abfrontier	100 ul	EUR 486.00
Description: Mouse Monoclonal to MDM4

Anti-MDM4 antibody
STJ111111	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhibit its activity, and have been shown to be overexpressed in a variety of human cancers. However, unlike MDM2 which degrades p53, this protein inhibits p53 by binding its transcriptional activation domain. This protein also interacts with MDM2 protein via the RING finger domain, and inhibits the latter's degradation. So this protein can reverse MDM2-targeted degradation of p53, while maintaining suppression of p53 transactivation and apoptotic functions. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

Protein MDMX (MDM4) Antibody
20-abx123850	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Protein MDMX (MDM4) Antibody
20-abx113634	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Phospho-MDM4 (Ser367) Antibody
AF7109	Affbiotech	200ul	EUR 376.00
Description: Phospho-MDM4 (Ser367) Antibody detects endogenous levels of MDM4 only when phosphorylated at Ser367.

Phospho-MDM4 (Ser342) Antibody
AF7110	Affbiotech	200ul	EUR 376.00
Description: Phospho-MDM4 (Ser342) Antibody detects endogenous levels of MDM4 only when phosphorylated at Ser342.

Polyclonal HdmX/MDM4 Antibody
AMM05324G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HdmX/MDM4 . This antibody is tested and proven to work in the following applications:

Rat MDM4 shRNA Plasmid
20-abx989289	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MDM4 Antibody, HRP conjugated
1-CSB-PA013627LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MDM4. Recognizes MDM4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MDM4 Antibody, FITC conjugated
1-CSB-PA013627LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MDM4. Recognizes MDM4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MDM4 Antibody, Biotin conjugated
1-CSB-PA013627LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MDM4. Recognizes MDM4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal MDM4 Antibody (Center)
APR08404G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MDM4 (Center). This antibody is tested and proven to work in the following applications:

Phospho-MDM4 (S367) Antibody
1-CSB-PA010531	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-MDM4 (S367). Recognizes Phospho-MDM4 (S367) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

MDM4 (Phospho-Ser342) Antibody
12973-100ul	SAB	100ul	EUR 252.00

MDM4 (Phospho-Ser342) Antibody
12973-50ul	SAB	50ul	EUR 187.00

MDM4 (Phospho-Ser367) Antibody
12141-100ul	SAB	100ul	EUR 252.00

MDM4 (Phospho-Ser367) Antibody
12141-50ul	SAB	50ul	EUR 187.00

Protein MDMX (MDM4) Antibody
abx037030-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Human MDM4 shRNA Plasmid
20-abx952854	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MDM4 shRNA Plasmid
20-abx971478	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Phospho-MDM4 (Ser367) Antibody
CSB-PA975669-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-MDM4 (Ser367). Recognizes Phospho-MDM4 (Ser367) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-MDM4 (Ser367) Antibody
CSB-PA975669-100ul	Cusabio	100ul	EUR 362.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-MDM4 (Ser367). Recognizes Phospho-MDM4 (Ser367) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Anti-MDMX/MDM4 Antibody
PB9872	BosterBio	100ug/vial	EUR 334.00

MDM4 Recombinant Protein (Human)
RP019054	ABM	100 ug	Ask for price

pCMV-SPORT6.1-MDM4 Plasmid
PVT16017	Lifescience Market	2 ug	EUR 325.00

MDM4 Recombinant Protein (Mouse)
RP149954	ABM	100 ug	Ask for price

MDM4 Recombinant Protein (Rat)
RP211220	ABM	100 ug	Ask for price

Phospho-MDM4 (Ser367) Blocking Peptide
AF7109-BP	Affbiotech	1mg	EUR 195.00

Phospho-MDM4 (Ser342) Blocking Peptide
AF7110-BP	Affbiotech	1mg	EUR 195.00

Monoclonal MDM4 Antibody, Clone: 2D10F4
AMM02677G	Leading Biology	0.1ml	EUR 484.00
Description: A Monoclonal antibody against Human MDM4. The antibodies are raised in Mouse and are from clone 2D10F4. This antibody is applicable in WB and IHC, ICC, E

MDM4 ORF Vector (Human) (pORF)
ORF006352	ABM	1.0 ug DNA	EUR 95.00

Mdm4 ORF Vector (Mouse) (pORF)
ORF049986	ABM	1.0 ug DNA	EUR 506.00

Mdm4 ORF Vector (Rat) (pORF)
ORF070408	ABM	1.0 ug DNA	EUR 506.00

pET28a-MDM4(1-137aa) Plasmid
PVTB00979-1a	Lifescience Market	2 ug	EUR 356.00

MDM4 (Phospho-Ser367) Polyclonal Conjugated Antibody
C12141	SAB	100ul	EUR 397.00

MDM4 (Phospho-Ser342) Polyclonal Conjugated Antibody
C12973	SAB	100ul	EUR 397.00

Polyclonal MDM4 antibody - N-terminal region
APR08405G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MDM4 - N-terminal region. This antibody is tested and proven to work in the following applications: