MUCL1

MUCL1 cloning plasmid
CSB-CL842658HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 273
  • Sequence: ATGAAGTTCTTAGCAGTCCTGGTACTCTTGGGAGTTTCCATCTTTCTGGTCTCTGCCCAGAATCCGACAACAGCTGCTCCAGCTGACACGTATCCAGCTACTGGTCCTGCTGATGATGAAGCCCCTGATGCTGAAACCACTGCTGCTGCAACCACTGCGACCACTGCTGCTCCTAC
  • Show more
Description: A cloning plasmid for the MUCL1 gene.

MUCL1 Polyclonal Antibody
A67814 100 µg
EUR 570.55
Description: reagents widely cited

MUCL1 protein (His tag)
80R-4015 20 ug
EUR 349
Description: Recombinant Human MUCL1 protein

Human MUCL1 ELISA Kit
ELA-E1840h 96 Tests
EUR 824

MUCL1 ELISA KIT|Human
EF006065 96 Tests
EUR 689

Human MUCL1 shRNA Plasmid
20-abx964581
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MUCL1 Recombinant Protein (Human)
RP041479 100 ug Ask for price

MUCL1 Recombinant Protein (Mouse)
RP152258 100 ug Ask for price

MUCL1 Polyclonal Antibody, HRP Conjugated
A67815 100 µg
EUR 570.55
Description: Ask the seller for details

MUCL1 Polyclonal Antibody, FITC Conjugated
A67816 100 µg
EUR 570.55
Description: The best epigenetics products

MUCL1 Polyclonal Antibody, Biotin Conjugated
A67817 100 µg
EUR 570.55
Description: kits suitable for this type of research

MUCL1 ORF Vector (Human) (pORF)
ORF013827 1.0 ug DNA
EUR 354

Mucl1 ORF Vector (Mouse) (pORF)
ORF050754 1.0 ug DNA
EUR 506

MUCL1 ELISA Kit (Human) (OKCD07722)
OKCD07722 96 Wells
EUR 936
Description: Description of target: May play a role as marker for the diagnosis of metastatic breast cancer.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.129ng/mL

MUCL1 ELISA Kit (Human) (OKEH04722)
OKEH04722 96 Wells
EUR 662
Description: Description of target: May play a role as marker for the diagnosis of metastatic breast cancer.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23 ng/mL

Mucl1 sgRNA CRISPR Lentivector set (Mouse)
K3007201 3 x 1.0 ug
EUR 339

MUCL1 sgRNA CRISPR Lentivector set (Human)
K1368301 3 x 1.0 ug
EUR 339

Mucl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3007202 1.0 ug DNA
EUR 154

Mucl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3007203 1.0 ug DNA
EUR 154

Mucl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3007204 1.0 ug DNA
EUR 154

MUCL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1368302 1.0 ug DNA
EUR 154

MUCL1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1368303 1.0 ug DNA
EUR 154

MUCL1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1368304 1.0 ug DNA
EUR 154

MUCL1 Mucin-Like 1 Human Recombinant Protein
PROTQ96DR8 Regular: 10ug
EUR 317
Description: MUCL1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 93 amino acids (21-90 a.a) and having a molecular mass of 9.3kDa. MUCL1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

MUCL1 Protein Vector (Mouse) (pPB-C-His)
PV203014 500 ng
EUR 603

MUCL1 Protein Vector (Mouse) (pPB-N-His)
PV203015 500 ng
EUR 603

MUCL1 Protein Vector (Mouse) (pPM-C-HA)
PV203016 500 ng
EUR 603

MUCL1 Protein Vector (Mouse) (pPM-C-His)
PV203017 500 ng
EUR 603

MUCL1 Protein Vector (Human) (pPB-C-His)
PV055305 500 ng
EUR 481

MUCL1 Protein Vector (Human) (pPB-N-His)
PV055306 500 ng
EUR 481

MUCL1 Protein Vector (Human) (pPM-C-HA)
PV055307 500 ng
EUR 481

MUCL1 Protein Vector (Human) (pPM-C-His)
PV055308 500 ng
EUR 481

Recombinant Human MUCL1 Protein, His, E.coli-100ug
QP12751-100ug 100ug
EUR 1261

Recombinant Human MUCL1 Protein, His, E.coli-10ug
QP12751-10ug 10ug
EUR 201

Recombinant Human MUCL1 Protein, His, E.coli-2ug
QP12751-2ug 2ug
EUR 155

Mucl1 3'UTR Luciferase Stable Cell Line
TU113626 1.0 ml Ask for price

Mucl1 3'UTR GFP Stable Cell Line
TU163626 1.0 ml Ask for price

MUCL1 3'UTR GFP Stable Cell Line
TU064976 1.0 ml
EUR 1394

MUCL1 3'UTR Luciferase Stable Cell Line
TU014976 1.0 ml
EUR 1394

Human Mucin-like protein 1 (MUCL1) ELISA Kit
abx251280-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human MUCL1/ Mucin-like protein 1 ELISA Kit
E1676Hu 1 Kit
EUR 571

Human MUCL1(Mucin-like protein 1) ELISA Kit
EH1958 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q96DR8
  • Alias: MUCL1(Mucin-like protein 1)/SBEM/Protein BS106/Small breast epithelial mucin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Mucin- like protein 1, MUCL1 ELISA KIT
ELI-05925h 96 Tests
EUR 824

ELISA kit for Human Mucin-like protein 1 (MUCL1)
KTE61450-48T 48T
EUR 332
  • MUCL1 (Mucin Like 1) is a Protein Coding gene. Diseases associated with MUCL1 include Breast Cancer. Among its related pathways are Immune System and HIV Life Cycle. May play a role as marker for the diagnosis of metastatic breast cancer.
Description: Quantitative sandwich ELISA for measuring Human Mucin-like protein 1 (MUCL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-like protein 1 (MUCL1)
KTE61450-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MUCL1 (Mucin Like 1) is a Protein Coding gene. Diseases associated with MUCL1 include Breast Cancer. Among its related pathways are Immune System and HIV Life Cycle. May play a role as marker for the diagnosis of metastatic breast cancer.
Description: Quantitative sandwich ELISA for measuring Human Mucin-like protein 1 (MUCL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-like protein 1 (MUCL1)
KTE61450-96T 96T
EUR 539
  • MUCL1 (Mucin Like 1) is a Protein Coding gene. Diseases associated with MUCL1 include Breast Cancer. Among its related pathways are Immune System and HIV Life Cycle. May play a role as marker for the diagnosis of metastatic breast cancer.
Description: Quantitative sandwich ELISA for measuring Human Mucin-like protein 1 (MUCL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mucl1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3007205 3 x 1.0 ug
EUR 376

MUCL1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1368305 3 x 1.0 ug
EUR 376

Mucl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3007206 1.0 ug DNA
EUR 167

Mucl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3007207 1.0 ug DNA
EUR 167

Mucl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3007208 1.0 ug DNA
EUR 167

MUCL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1368306 1.0 ug DNA
EUR 167

MUCL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1368307 1.0 ug DNA
EUR 167

MUCL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1368308 1.0 ug DNA
EUR 167