MUCL1

MUCL1 Polyclonal Antibody
A67814	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

MUCL1 cloning plasmid
CSB-CL842658HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 273 Sequence: ATGAAGTTCTTAGCAGTCCTGGTACTCTTGGGAGTTTCCATCTTTCTGGTCTCTGCCCAGAATCCGACAACAGCTGCTCCAGCTGACACGTATCCAGCTACTGGTCCTGCTGATGATGAAGCCCCTGATGCTGAAACCACTGCTGCTGCAACCACTGCGACCACTGCTGCTCCTAC Show more
Description: A cloning plasmid for the MUCL1 gene.

Human MUCL1 shRNA Plasmid
20-abx964581	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human MUCL1 ELISA Kit
ELA-E1840h	Lifescience Market	96 Tests	EUR 824

MUCL1 ELISA KIT|Human
EF006065	Lifescience Market	96 Tests	EUR 689

MUCL1 protein (His tag)
80R-4015	Fitzgerald	20 ug	EUR 349
Description: Recombinant Human MUCL1 protein

MUCL1 Recombinant Protein (Human)
RP041479	ABM	100 ug	Ask for price

MUCL1 Recombinant Protein (Mouse)
RP152258	ABM	100 ug	Ask for price

MUCL1 Polyclonal Antibody, HRP Conjugated
A67815	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

MUCL1 Polyclonal Antibody, FITC Conjugated
A67816	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

MUCL1 Polyclonal Antibody, Biotin Conjugated
A67817	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Mucl1 ORF Vector (Mouse) (pORF)
ORF050754	ABM	1.0 ug DNA	EUR 506

MUCL1 ORF Vector (Human) (pORF)
ORF013827	ABM	1.0 ug DNA	EUR 354

MUCL1 ELISA Kit (Human) (OKCD07722)
OKCD07722	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: May play a role as marker for the diagnosis of metastatic breast cancer.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.129ng/mL

MUCL1 ELISA Kit (Human) (OKEH04722)
OKEH04722	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: May play a role as marker for the diagnosis of metastatic breast cancer.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23 ng/mL

Mucl1 sgRNA CRISPR Lentivector set (Mouse)
K3007201	ABM	3 x 1.0 ug	EUR 339

MUCL1 sgRNA CRISPR Lentivector set (Human)
K1368301	ABM	3 x 1.0 ug	EUR 339

Mucl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3007202	ABM	1.0 ug DNA	EUR 154

Mucl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3007203	ABM	1.0 ug DNA	EUR 154

Mucl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3007204	ABM	1.0 ug DNA	EUR 154

MUCL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1368302	ABM	1.0 ug DNA	EUR 154

MUCL1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1368303	ABM	1.0 ug DNA	EUR 154

MUCL1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1368304	ABM	1.0 ug DNA	EUR 154

MUCL1 Protein Vector (Human) (pPB-C-His)
PV055305	ABM	500 ng	EUR 481

MUCL1 Protein Vector (Human) (pPB-N-His)
PV055306	ABM	500 ng	EUR 481

MUCL1 Protein Vector (Human) (pPM-C-HA)
PV055307	ABM	500 ng	EUR 481

MUCL1 Protein Vector (Human) (pPM-C-His)
PV055308	ABM	500 ng	EUR 481

Recombinant Human MUCL1 Protein, His, E.coli-100ug
QP12751-100ug	EnQuireBio	100ug	EUR 1261

Recombinant Human MUCL1 Protein, His, E.coli-10ug
QP12751-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human MUCL1 Protein, His, E.coli-2ug
QP12751-2ug	EnQuireBio	2ug	EUR 155

MUCL1 Mucin-Like 1 Human Recombinant Protein
PROTQ96DR8	BosterBio	Regular: 10ug	EUR 317
Description: MUCL1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 93 amino acids (21-90 a.a) and having a molecular mass of 9.3kDa. MUCL1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

MUCL1 Protein Vector (Mouse) (pPB-C-His)
PV203014	ABM	500 ng	EUR 603

MUCL1 Protein Vector (Mouse) (pPB-N-His)
PV203015	ABM	500 ng	EUR 603

MUCL1 Protein Vector (Mouse) (pPM-C-HA)
PV203016	ABM	500 ng	EUR 603

MUCL1 Protein Vector (Mouse) (pPM-C-His)
PV203017	ABM	500 ng	EUR 603

Mucl1 3'UTR GFP Stable Cell Line
TU163626	ABM	1.0 ml	Ask for price

MUCL1 3'UTR Luciferase Stable Cell Line
TU014976	ABM	1.0 ml	EUR 1394

Mucl1 3'UTR Luciferase Stable Cell Line
TU113626	ABM	1.0 ml	Ask for price

MUCL1 3'UTR GFP Stable Cell Line
TU064976	ABM	1.0 ml	EUR 1394

Human MUCL1/ Mucin-like protein 1 ELISA Kit
E1676Hu	Sunlong	1 Kit	EUR 571

Human MUCL1(Mucin-like protein 1) ELISA Kit
EH1958	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q96DR8 Alias: MUCL1(Mucin-like protein 1)/SBEM/Protein BS106/Small breast epithelial mucin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Mucin- like protein 1, MUCL1 ELISA KIT
ELI-05925h	Lifescience Market	96 Tests	EUR 824

Human Mucin-like protein 1 (MUCL1) ELISA Kit
abx251280-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Mucin-like protein 1 (MUCL1)
KTE61450-48T	Abbkine	48T	EUR 332
MUCL1 (Mucin Like 1) is a Protein Coding gene. Diseases associated with MUCL1 include Breast Cancer. Among its related pathways are Immune System and HIV Life Cycle. May play a role as marker for the diagnosis of metastatic breast cancer.
Description: Quantitative sandwich ELISA for measuring Human Mucin-like protein 1 (MUCL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-like protein 1 (MUCL1)
KTE61450-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MUCL1 (Mucin Like 1) is a Protein Coding gene. Diseases associated with MUCL1 include Breast Cancer. Among its related pathways are Immune System and HIV Life Cycle. May play a role as marker for the diagnosis of metastatic breast cancer.
Description: Quantitative sandwich ELISA for measuring Human Mucin-like protein 1 (MUCL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-like protein 1 (MUCL1)
KTE61450-96T	Abbkine	96T	EUR 539
MUCL1 (Mucin Like 1) is a Protein Coding gene. Diseases associated with MUCL1 include Breast Cancer. Among its related pathways are Immune System and HIV Life Cycle. May play a role as marker for the diagnosis of metastatic breast cancer.
Description: Quantitative sandwich ELISA for measuring Human Mucin-like protein 1 (MUCL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mucl1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3007205	ABM	3 x 1.0 ug	EUR 376

MUCL1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1368305	ABM	3 x 1.0 ug	EUR 376

Mucl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3007206	ABM	1.0 ug DNA	EUR 167

Mucl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3007207	ABM	1.0 ug DNA	EUR 167

Mucl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3007208	ABM	1.0 ug DNA	EUR 167

MUCL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1368306	ABM	1.0 ug DNA	EUR 167

MUCL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1368307	ABM	1.0 ug DNA	EUR 167

MUCL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1368308	ABM	1.0 ug DNA	EUR 167