MUL1

MUL1 Antibody
44855-100ul	SAB	100ul	EUR 252

MUL1 Antibody
44855-50ul	SAB	50ul	EUR 187

MUL1 Antibody
DF2589	Affbiotech	200ul	EUR 304
Description: MUL1 antibody detects endogenous levels of total MUL1.

MUL1 Antibody
1-CSB-PA015235GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MUL1. Recognizes MUL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

MUL1 siRNA
20-abx925035	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MUL1 siRNA
20-abx925036	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MUL1 Antibody
ABD2589	Lifescience Market	100 ug	EUR 438

MUL1 Rabbit pAb
A13125-100ul	Abclonal	100 ul	EUR 308

MUL1 Rabbit pAb
A13125-200ul	Abclonal	200 ul	EUR 459

MUL1 Rabbit pAb
A13125-20ul	Abclonal	20 ul	EUR 183

MUL1 Rabbit pAb
A13125-50ul	Abclonal	50 ul	EUR 223

MUL1 Blocking Peptide
DF2589-BP	Affbiotech	1mg	EUR 195

MUL1 Conjugated Antibody
C44855	SAB	100ul	EUR 397

MUL1 cloning plasmid
CSB-CL839281HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1059 Sequence: atggagagcggagggcggccctcgctgtgccagttcatcctcctgggcaccacctctgtggtcaccgccgccctgtactccgtgtaccggcagaaggcccgggtctcccaagagctcaagggagctaaaaaagttcatttgggtgaagatttaaagagtattctttcagaagctc Show more
Description: A cloning plasmid for the MUL1 gene.

MUL1 Rabbit pAb
A9164-100ul	Abclonal	100 ul	EUR 308

MUL1 Rabbit pAb
A9164-200ul	Abclonal	200 ul	EUR 459

MUL1 Rabbit pAb
A9164-20ul	Abclonal	20 ul	Ask for price

MUL1 Rabbit pAb
A9164-50ul	Abclonal	50 ul	Ask for price

MUL1 Polyclonal Antibody
ABP59346-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human MUL1 protein Applications tips:
Description: A polyclonal antibody for detection of MUL1 from Human, Mouse. This MUL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUL1 protein

MUL1 Polyclonal Antibody
ABP59346-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MUL1 protein Applications tips:
Description: A polyclonal antibody for detection of MUL1 from Human, Mouse. This MUL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUL1 protein

MUL1 Polyclonal Antibody
ABP59346-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MUL1 protein Applications tips:
Description: A polyclonal antibody for detection of MUL1 from Human, Mouse. This MUL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUL1 protein

anti- MUL1 antibody
FNab05435	FN Test	100µg	EUR 505.25
Immunogen: mitochondrial E3 ubiquitin ligase 1 Uniprot ID: Q969V5 Gene ID: 79594 Research Area: Epigenetics, Signal Transduction, Metabolism
Description: Antibody raised against MUL1

MUL1 Polyclonal Antibody
ES10762-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MUL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MUL1 Polyclonal Antibody
ES10762-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MUL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-MUL1 antibody
PAab05435	Lifescience Market	100 ug	EUR 355

pENTR223-MUL1 vector
PVT12017	Lifescience Market	2 ug	EUR 308

Anti-MUL1 antibody
STJ111593	St John's Laboratory	100 µl	EUR 277

Anti-MUL1 antibody
STJ115091	St John's Laboratory	100 µl	EUR 277

Anti-MUL1 antibody
STJ191920	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MUL1

Mouse Mul1 ELISA KIT
ELI-12941m	Lifescience Market	96 Tests	EUR 865

Human MUL1 ELISA KIT
ELI-42336h	Lifescience Market	96 Tests	EUR 824

Mouse MUL1 shRNA Plasmid
20-abx976594	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Polyclonal MUL1 Antibody (Center)
APR08576G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUL1 (Center). This antibody is tested and proven to work in the following applications:

Human MUL1 shRNA Plasmid
20-abx962413	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MUL1 Recombinant Protein (Human)
RP020398	ABM	100 ug	Ask for price

MUL1 Recombinant Protein (Mouse)
RP152270	ABM	100 ug	Ask for price

MUL1 Recombinant Protein (Rat)
RP212789	ABM	100 ug	Ask for price

Polyclonal MUL1 Antibody (C-term)
APR08575G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUL1 (C-term). This antibody is tested and proven to work in the following applications:

Mul1 ORF Vector (Rat) (pORF)
ORF070931	ABM	1.0 ug DNA	EUR 506

MUL1 ORF Vector (Human) (pORF)
ORF006800	ABM	1.0 ug DNA	EUR 95

Mul1 ORF Vector (Mouse) (pORF)
ORF050758	ABM	1.0 ug DNA	EUR 506

MUL1 ELISA Kit (Human) (OKWB00235)
OKWB00235	Aviva Systems Biology	96 Wells	EUR 572
Description: Description of target: Exhibits weak E3 ubiquitin-protein ligase activity. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfer the ubiquitin to targeted substrates. Can ubiquitinate AKT1 preferentially at 'Lys-284' involving 'Lys-48'-linked polyubiquitination and seems to be involved in regulation of Akt signaling by targeting phosphorylated Akt to proteosomal degradation. Proposed to preferentially act as a SUMO E3 ligase at physiological concentrations. Plays a role in the control of mitochondrial morphology. Promotes mitochondrial fragmentation and influences mitochondrial localization. The function may implicate its ability to sumoylate DNM1L. Inhibits cell growth. When overexpressed, activates JNK through MAP3K7/TAK1 and induces caspase-dependent apoptosis. Involved in the modulation of innate immune defense against viruses by inhibiting DDX58-dependent antiviral response. Can mediate DDX58 sumoylation and disrupt its polyubiquitination.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Mul1 sgRNA CRISPR Lentivector set (Mouse)
K3239701	ABM	3 x 1.0 ug	EUR 339

MUL1 sgRNA CRISPR Lentivector set (Human)
K1368501	ABM	3 x 1.0 ug	EUR 339

anti-E3 ubiquitin-protein ligase MUL1
YF-PA26608	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to E3 ubiquitin-protein ligase MUL1

Mul1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3239702	ABM	1.0 ug DNA	EUR 154

Mul1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3239703	ABM	1.0 ug DNA	EUR 154

Mul1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3239704	ABM	1.0 ug DNA	EUR 154

MUL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1368502	ABM	1.0 ug DNA	EUR 154

MUL1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1368503	ABM	1.0 ug DNA	EUR 154

MUL1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1368504	ABM	1.0 ug DNA	EUR 154

MUL1 Protein Vector (Mouse) (pPB-C-His)
PV203030	ABM	500 ng	EUR 603

MUL1 Protein Vector (Mouse) (pPB-N-His)
PV203031	ABM	500 ng	EUR 603

MUL1 Protein Vector (Mouse) (pPM-C-HA)
PV203032	ABM	500 ng	EUR 603

MUL1 Protein Vector (Mouse) (pPM-C-His)
PV203033	ABM	500 ng	EUR 603

MUL1 Protein Vector (Rat) (pPB-C-His)
PV283722	ABM	500 ng	EUR 603

MUL1 Protein Vector (Rat) (pPB-N-His)
PV283723	ABM	500 ng	EUR 603

MUL1 Protein Vector (Rat) (pPM-C-HA)
PV283724	ABM	500 ng	EUR 603

MUL1 Protein Vector (Rat) (pPM-C-His)
PV283725	ABM	500 ng	EUR 603

MUL1 Protein Vector (Human) (pPB-C-His)
PV027197	ABM	500 ng	EUR 329

MUL1 Protein Vector (Human) (pPB-N-His)
PV027198	ABM	500 ng	EUR 329

MUL1 Protein Vector (Human) (pPM-C-HA)
PV027199	ABM	500 ng	EUR 329

MUL1 Protein Vector (Human) (pPM-C-His)
PV027200	ABM	500 ng	EUR 329

Mul1 3'UTR Luciferase Stable Cell Line
TU113630	ABM	1.0 ml	Ask for price

Mul1 3'UTR GFP Stable Cell Line
TU163630	ABM	1.0 ml	Ask for price

MUL1 3'UTR GFP Stable Cell Line
TU064978	ABM	1.0 ml	EUR 1394

MUL1 3'UTR Luciferase Stable Cell Line
TU014978	ABM	1.0 ml	EUR 1394

MUL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV639661	ABM	1.0 ug DNA	EUR 682

MUL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV639665	ABM	1.0 ug DNA	EUR 682

MUL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV639666	ABM	1.0 ug DNA	EUR 682

Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody
abx027028-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody
abx027028-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody
20-abx124782	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody
20-abx147625	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody
abx235435-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Mul1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3239705	ABM	3 x 1.0 ug	EUR 376

MUL1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1368505	ABM	3 x 1.0 ug	EUR 376

MUL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV639662	ABM	1.0 ug DNA	EUR 682

MUL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV639663	ABM	1.0 ug DNA	EUR 740

MUL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV639664	ABM	1.0 ug DNA	EUR 740

Mul1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3239706	ABM	1.0 ug DNA	EUR 167

Mul1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3239707	ABM	1.0 ug DNA	EUR 167

Mul1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3239708	ABM	1.0 ug DNA	EUR 167

MUL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1368506	ABM	1.0 ug DNA	EUR 167

MUL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1368507	ABM	1.0 ug DNA	EUR 167

MUL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1368508	ABM	1.0 ug DNA	EUR 167