MUL1

MUL1 siRNA

20-abx925036
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MUL1 antibody

70R-18680 50 ul
EUR 435.00
Description: Rabbit polyclonal MUL1 antibody

MUL1 Antibody

ABD2589 100 ug
EUR 438.00

MUL1 Antibody

DF2589 200ul
EUR 304.00
Description: MUL1 antibody detects endogenous levels of total MUL1.

MUL1 Antibody

44855-100ul 100ul
EUR 252.00

MUL1 Antibody

44855-50ul 50ul
EUR 187.00

MUL1 Antibody

1-CSB-PA015235GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MUL1. Recognizes MUL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

MUL1 Rabbit pAb

A9164-100ul 100 ul
EUR 308.00

MUL1 Rabbit pAb

A9164-200ul 200 ul
EUR 459.00

MUL1 Rabbit pAb

A9164-20ul 20 ul Ask for price

MUL1 Rabbit pAb

A9164-50ul 50 ul Ask for price

MUL1 Rabbit pAb

A13125-100ul 100 ul
EUR 308.00

MUL1 Rabbit pAb

A13125-200ul 200 ul
EUR 459.00

MUL1 Rabbit pAb

A13125-20ul 20 ul
EUR 183.00

MUL1 Rabbit pAb

A13125-50ul 50 ul
EUR 223.00

MUL1 Blocking Peptide

DF2589-BP 1mg
EUR 195.00

MUL1 Conjugated Antibody

C44855 100ul
EUR 397.00

MUL1 Polyclonal Antibody

ABP59346-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human MUL1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MUL1 from Human, Mouse. This MUL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUL1 protein

MUL1 Polyclonal Antibody

ABP59346-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human MUL1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MUL1 from Human, Mouse. This MUL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUL1 protein

MUL1 Polyclonal Antibody

ABP59346-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human MUL1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MUL1 from Human, Mouse. This MUL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUL1 protein

MUL1 cloning plasmid

CSB-CL839281HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1059
  • Sequence: atggagagcggagggcggccctcgctgtgccagttcatcctcctgggcaccacctctgtggtcaccgccgccctgtactccgtgtaccggcagaaggcccgggtctcccaagagctcaagggagctaaaaaagttcatttgggtgaagatttaaagagtattctttcagaagctc
  • Show more
Description: A cloning plasmid for the MUL1 gene.

Anti-MUL1 antibody

PAab05435 100 ug
EUR 355.00

MUL1 Polyclonal Antibody

ES10762-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against MUL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MUL1 Polyclonal Antibody

ES10762-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against MUL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- MUL1 antibody

FNab05435 100µg
EUR 505.25
  • Immunogen: mitochondrial E3 ubiquitin ligase 1
  • Uniprot ID: Q969V5
  • Gene ID: 79594
  • Research Area: Epigenetics, Signal Transduction, Metabolism
Description: Antibody raised against MUL1

Anti-MUL1 antibody

STJ111593 100 µl
EUR 277.00

pENTR223-MUL1 vector

PVT12017 2 ug
EUR 308.00

Anti-MUL1 antibody

STJ191920 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to MUL1

Anti-MUL1 antibody

STJ115091 100 µl
EUR 277.00

Human MUL1 shRNA Plasmid

20-abx962413
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MUL1 shRNA Plasmid

20-abx976594
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal MUL1 Antibody (Center)

APR08576G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUL1 (Center). This antibody is tested and proven to work in the following applications:

Mouse Mul1 ELISA KIT

ELI-12941m 96 Tests
EUR 865.00

Human MUL1 ELISA KIT

ELI-42336h 96 Tests
EUR 824.00

MUL1 Recombinant Protein (Rat)

RP212789 100 ug Ask for price

MUL1 Recombinant Protein (Human)

RP020398 100 ug Ask for price

MUL1 Recombinant Protein (Mouse)

RP152270 100 ug Ask for price

Polyclonal MUL1 Antibody (C-term)

APR08575G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUL1 (C-term). This antibody is tested and proven to work in the following applications:

Mul1 ORF Vector (Rat) (pORF)

ORF070931 1.0 ug DNA
EUR 506.00

Mul1 ORF Vector (Mouse) (pORF)

ORF050758 1.0 ug DNA
EUR 506.00

MUL1 ORF Vector (Human) (pORF)

ORF006800 1.0 ug DNA
EUR 95.00

MUL1 sgRNA CRISPR Lentivector set (Human)

K1368501 3 x 1.0 ug
EUR 339.00

Mul1 sgRNA CRISPR Lentivector set (Mouse)

K3239701 3 x 1.0 ug
EUR 339.00

anti-E3 ubiquitin-protein ligase MUL1

YF-PA26608 50 ul
EUR 334.00
Description: Mouse polyclonal to E3 ubiquitin-protein ligase MUL1

MUL1 Protein Vector (Human) (pPB-C-His)

PV027197 500 ng
EUR 329.00

MUL1 Protein Vector (Human) (pPB-N-His)

PV027198 500 ng
EUR 329.00

MUL1 Protein Vector (Human) (pPM-C-HA)

PV027199 500 ng
EUR 329.00

MUL1 Protein Vector (Human) (pPM-C-His)

PV027200 500 ng
EUR 329.00

MUL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1368502 1.0 ug DNA
EUR 154.00

MUL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1368503 1.0 ug DNA
EUR 154.00

MUL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1368504 1.0 ug DNA
EUR 154.00

Mul1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3239702 1.0 ug DNA
EUR 154.00

Mul1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3239703 1.0 ug DNA
EUR 154.00

Mul1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3239704 1.0 ug DNA
EUR 154.00

MUL1 3'UTR Luciferase Stable Cell Line

TU014978 1.0 ml
EUR 1394.00

MUL1 3'UTR GFP Stable Cell Line

TU064978 1.0 ml
EUR 1394.00

MUL1 Protein Vector (Mouse) (pPB-C-His)

PV203030 500 ng
EUR 603.00

MUL1 Protein Vector (Mouse) (pPB-N-His)

PV203031 500 ng
EUR 603.00

MUL1 Protein Vector (Mouse) (pPM-C-HA)

PV203032 500 ng
EUR 603.00

MUL1 Protein Vector (Mouse) (pPM-C-His)

PV203033 500 ng
EUR 603.00

MUL1 Protein Vector (Rat) (pPB-C-His)

PV283722 500 ng
EUR 603.00

MUL1 Protein Vector (Rat) (pPB-N-His)

PV283723 500 ng
EUR 603.00

MUL1 Protein Vector (Rat) (pPM-C-HA)

PV283724 500 ng
EUR 603.00

MUL1 Protein Vector (Rat) (pPM-C-His)

PV283725 500 ng
EUR 603.00

Mul1 3'UTR GFP Stable Cell Line

TU163630 1.0 ml Ask for price

Mul1 3'UTR Luciferase Stable Cell Line

TU113630 1.0 ml Ask for price

MUL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV639661 1.0 ug DNA
EUR 682.00

MUL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV639665 1.0 ug DNA
EUR 682.00

MUL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV639666 1.0 ug DNA
EUR 682.00

Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody

abx235435-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody

abx027028-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody

abx027028-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody

20-abx124782
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody

20-abx147625
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

MUL1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1368505 3 x 1.0 ug
EUR 376.00

Mul1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3239705 3 x 1.0 ug
EUR 376.00

MUL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1368506 1.0 ug DNA
EUR 167.00

MUL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1368507 1.0 ug DNA
EUR 167.00

MUL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1368508 1.0 ug DNA
EUR 167.00

MUL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV639662 1.0 ug DNA
EUR 682.00

MUL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV639663 1.0 ug DNA
EUR 740.00

MUL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV639664 1.0 ug DNA
EUR 740.00

Mul1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3239706 1.0 ug DNA
EUR 167.00

Mul1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3239707 1.0 ug DNA
EUR 167.00

Mul1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3239708 1.0 ug DNA
EUR 167.00