NAPB

NAPB Antibody

1-CSB-PA015448GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NAPB. Recognizes NAPB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

NAPB antibody

70R-18751 50 ul
EUR 435.00
Description: Rabbit polyclonal NAPB antibody

NAPB siRNA

20-abx925402
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAPB siRNA

20-abx925403
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAPB antibody

70R-10558 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal NAPB antibody

NAPB cloning plasmid

CSB-CL863947HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 897
  • Sequence: atggacaacgcggggaaggagcgtgaggcagtacagctgatggcggaggccgagaagcgagtcaaggcctcccactccttcctccgagggctgtttggaggaaacacaagaatagaagaggcttgtgaaatgtataccagagctgcaaatatgttcaagatggctaaaaattggag
  • Show more
Description: A cloning plasmid for the NAPB gene.

NAPB Blocking Peptide

33R-5852 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NAPB antibody, catalog no. 70R-10558

NAPB Polyclonal Antibody

30370-100ul 100ul
EUR 252.00

NAPB Polyclonal Antibody

30370-50ul 50ul
EUR 187.00

NAPB Rabbit pAb

A4913-100ul 100 ul
EUR 308.00

NAPB Rabbit pAb

A4913-200ul 200 ul
EUR 459.00

NAPB Rabbit pAb

A4913-20ul 20 ul Ask for price

NAPB Rabbit pAb

A4913-50ul 50 ul Ask for price

NAPB Rabbit pAb

A18223-100ul 100 ul
EUR 308.00

NAPB Rabbit pAb

A18223-200ul 200 ul
EUR 459.00

NAPB Rabbit pAb

A18223-20ul 20 ul
EUR 183.00

NAPB Rabbit pAb

A18223-50ul 50 ul
EUR 223.00

anti- NAPB antibody

FNab05546 100µg
EUR 505.25
  • Immunogen: N-ethylmaleimide-sensitive factor attachment protein, beta
  • Uniprot ID: Q9H115
  • Gene ID: 63908
  • Research Area: Signal Transduction
Description: Antibody raised against NAPB

Anti-NAPB antibody

PAab05546 100 ug
EUR 355.00

Anti-NAPB antibody

STJ11100180 100 µl
EUR 277.00
Description: This gene encodes a member of the soluble N-ethyl-maleimide-sensitive fusion attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. This gene encodes the SNAP beta isoform which has been shown to be preferentially expressed in brain tissue. The encoded protein also interacts with the GluR2 &945;-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor subunit C-terminus and may play a role as a chaperone in the molecular processing of the AMPA receptor.

Anti-NAPB antibody

STJ26954 100 µl
EUR 277.00
Description: This gene encodes a member of the soluble N-ethyl-maleimide-sensitive fusion attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. This gene encodes the SNAP beta isoform which has been shown to be preferentially expressed in brain tissue. The encoded protein also interacts with the GluR2 alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor subunit C-terminus and may play a role as a chaperone in the molecular processing of the AMPA receptor.

NAPB Polyclonal Conjugated Antibody

C30370 100ul
EUR 397.00

Human NAPB shRNA Plasmid

20-abx961855
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NAPB shRNA Plasmid

20-abx971681
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NAPB ELISA KIT|Human

EF001079 96 Tests
EUR 689.00

NAPB Recombinant Protein (Human)

RP020668 100 ug Ask for price

NAPB Recombinant Protein (Mouse)

RP153077 100 ug Ask for price

NAPB Recombinant Protein (Rat)

RP213266 100 ug Ask for price

Polyclonal NAPB Antibody (N-term)

AMM06546G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NAPB (N-term). This antibody is tested and proven to work in the following applications:

NAPB ORF Vector (Human) (pORF)

ORF006890 1.0 ug DNA
EUR 95.00

Napb ORF Vector (Mouse) (pORF)

ORF051027 1.0 ug DNA
EUR 506.00

Napb ORF Vector (Rat) (pORF)

ORF071090 1.0 ug DNA
EUR 506.00

NSF Attachment Protein Beta (NAPB) Antibody

20-abx114053
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

NSF Attachment Protein Beta (NAPB) Antibody

20-abx003734
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

NSF Attachment Protein Beta (NAPB) Antibody

abx027911-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

NSF Attachment Protein Beta (NAPB) Antibody

abx027911-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

NSF Attachment Protein Beta (NAPB) Antibody

abx235546-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

NAPB sgRNA CRISPR Lentivector set (Human)

K1390501 3 x 1.0 ug
EUR 339.00

Napb sgRNA CRISPR Lentivector set (Rat)

K6243701 3 x 1.0 ug
EUR 339.00

Napb sgRNA CRISPR Lentivector set (Mouse)

K3656301 3 x 1.0 ug
EUR 339.00

NAPB sgRNA CRISPR Lentivector (Human) (Target 1)

K1390502 1.0 ug DNA
EUR 154.00

NAPB sgRNA CRISPR Lentivector (Human) (Target 2)

K1390503 1.0 ug DNA
EUR 154.00

NAPB sgRNA CRISPR Lentivector (Human) (Target 3)

K1390504 1.0 ug DNA
EUR 154.00

Napb sgRNA CRISPR Lentivector (Rat) (Target 1)

K6243702 1.0 ug DNA
EUR 154.00

Napb sgRNA CRISPR Lentivector (Rat) (Target 2)

K6243703 1.0 ug DNA
EUR 154.00

Napb sgRNA CRISPR Lentivector (Rat) (Target 3)

K6243704 1.0 ug DNA
EUR 154.00

Napb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3656302 1.0 ug DNA
EUR 154.00

Napb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3656303 1.0 ug DNA
EUR 154.00

Napb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3656304 1.0 ug DNA
EUR 154.00

NAPB Protein Vector (Rat) (pPB-C-His)

PV284358 500 ng
EUR 603.00

NAPB Protein Vector (Rat) (pPB-N-His)

PV284359 500 ng
EUR 603.00

NAPB Protein Vector (Rat) (pPM-C-HA)

PV284360 500 ng
EUR 603.00

NAPB Protein Vector (Rat) (pPM-C-His)

PV284361 500 ng
EUR 603.00

NAPB Protein Vector (Mouse) (pPB-C-His)

PV204106 500 ng
EUR 603.00

NAPB Protein Vector (Mouse) (pPB-N-His)

PV204107 500 ng
EUR 603.00

NAPB Protein Vector (Mouse) (pPM-C-HA)

PV204108 500 ng
EUR 603.00

NAPB Protein Vector (Mouse) (pPM-C-His)

PV204109 500 ng
EUR 603.00

NAPB Protein Vector (Human) (pPB-C-His)

PV027557 500 ng
EUR 329.00

NAPB Protein Vector (Human) (pPB-N-His)

PV027558 500 ng
EUR 329.00

NAPB Protein Vector (Human) (pPM-C-HA)

PV027559 500 ng
EUR 329.00

NAPB Protein Vector (Human) (pPM-C-His)

PV027560 500 ng
EUR 329.00

Napb 3'UTR Luciferase Stable Cell Line

TU113836 1.0 ml Ask for price

NAPB 3'UTR Luciferase Stable Cell Line

TU015225 1.0 ml
EUR 2333.00

Napb 3'UTR GFP Stable Cell Line

TU163836 1.0 ml Ask for price

Napb 3'UTR Luciferase Stable Cell Line

TU213742 1.0 ml Ask for price

NAPB 3'UTR GFP Stable Cell Line

TU065225 1.0 ml
EUR 2333.00

Napb 3'UTR GFP Stable Cell Line

TU263742 1.0 ml Ask for price

NAPB Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV699223 1.0 ug DNA
EUR 514.00

NAPB Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV699227 1.0 ug DNA
EUR 514.00

NAPB Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV699228 1.0 ug DNA
EUR 514.00

Bovine Beta- soluble NSF attachment protein, NAPB ELISA KIT

ELI-53276b 96 Tests
EUR 928.00

Human Beta- soluble NSF attachment protein, NAPB ELISA KIT

ELI-42432h 96 Tests
EUR 824.00

Monkey β soluble NSF attachment protein(NAPB) ELISA kit

E09B0951-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β soluble NSF attachment protein(NAPB) ELISA kit

E09B0951-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β soluble NSF attachment protein(NAPB) ELISA kit

E09B0951-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta- soluble NSF attachment protein, Napb ELISA KIT

ELI-19985m 96 Tests
EUR 865.00

Human β soluble NSF attachment protein(NAPB) ELISA kit

E01B0951-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β soluble NSF attachment protein(NAPB) ELISA kit

E01B0951-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β soluble NSF attachment protein(NAPB) ELISA kit

E01B0951-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β soluble NSF attachment protein(NAPB) ELISA kit

E07B0951-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β soluble NSF attachment protein(NAPB) ELISA kit

E07B0951-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β soluble NSF attachment protein(NAPB) ELISA kit

E07B0951-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β soluble NSF attachment protein(NAPB) ELISA kit

E04B0951-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β soluble NSF attachment protein(NAPB) ELISA kit

E04B0951-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β soluble NSF attachment protein(NAPB) ELISA kit

E04B0951-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β soluble NSF attachment protein(NAPB) ELISA kit

E02B0951-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β soluble NSF attachment protein(NAPB) ELISA kit

E02B0951-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β soluble NSF attachment protein(NAPB) ELISA kit

E02B0951-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β soluble NSF attachment protein(NAPB) ELISA kit

E08B0951-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β soluble NSF attachment protein(NAPB) ELISA kit

E08B0951-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β soluble NSF attachment protein(NAPB) ELISA kit

E08B0951-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β soluble NSF attachment protein(NAPB) ELISA kit

E06B0951-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β soluble NSF attachment protein(NAPB) ELISA kit

E06B0951-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β soluble NSF attachment protein(NAPB) ELISA kit

E06B0951-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β soluble NSF attachment protein(NAPB) ELISA kit

E03B0951-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse β soluble NSF attachment protein(NAPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.