Gentaur Cz

Lékařská biotechnologická výzkumná laboratoř

PIAS1

PIAS1 Antibody
ABF0561 100 ug
EUR 438

PIAS1 siRNA
20-abx928532
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIAS1 siRNA
20-abx928533
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIAS1 antibody
70R-30795 100 ug
EUR 327
Description: Rabbit polyclonal PIAS1 antibody

PIAS1 antibody
38687-100ul 100ul
EUR 252

PIAS1 Antibody
33515-100ul 100ul
EUR 252

PIAS1 Antibody
33515-50ul 50ul
EUR 187

PIAS1 Antibody
25111-100ul 100ul
EUR 390

PIAS1 Antibody
1-CSB-PA003776
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PIAS1. Recognizes PIAS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

PIAS1 Antibody
CSB-PA158229-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PIAS1. Recognizes PIAS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

PIAS1 Antibody
CSB-PA158229-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PIAS1. Recognizes PIAS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

PIAS1 Antibody
1-CSB-PA037444
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PIAS1. Recognizes PIAS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

PIAS1 Antibody
1-CSB-PA017957ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PIAS1. Recognizes PIAS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-PIAS1
YF-PA15699 50 ug
EUR 363
Description: Mouse polyclonal to PIAS1

anti-PIAS1
YF-PA15700 100 ul
EUR 403
Description: Rabbit polyclonal to PIAS1

anti-PIAS1
YF-PA27411 50 ul
EUR 363
Description: Mouse polyclonal to PIAS1

PIAS1 Conjugated Antibody
C33515 100ul
EUR 397

PIAS1 Blocking Peptide
AF0561-BP 1mg
EUR 195

PIAS1 cloning plasmid
CSB-CL017957HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1956
  • Sequence: ATGGCGGACAGTGCGGAACTAAAGCAAATGGTTATGAGCCTTAGAGTTTCTGAACTCCAAGTACTGTTGGGCTACGCCGGGAGAAACAAGCACGGACGCAAACACGAACTTCTCACAAAAGCCCTGCATTTGCTAAAGGCTGGCTGTAGTCCTGCTGTGCAAATGAAAATTAAGG
  • Show more
Description: A cloning plasmid for the PIAS1 gene.

anti- PIAS1 antibody
FNab06428 100µg
EUR 585
  • Immunogen: protein inhibitor of activated STAT, 1
  • Uniprot ID: O75925
  • Gene ID: 8554
  • Research Area: Metabolism
Description: Antibody raised against PIAS1

PIAS1 Blocking Peptide
20-abx061674
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PIAS1 Rabbit pAb
A1007-100ul 100 ul
EUR 308

PIAS1 Rabbit pAb
A1007-200ul 200 ul
EUR 459

PIAS1 Rabbit pAb
A1007-20ul 20 ul
EUR 183

PIAS1 Rabbit pAb
A1007-50ul 50 ul
EUR 223

PIAS1 Rabbit pAb
A5729-100ul 100 ul
EUR 308

PIAS1 Rabbit pAb
A5729-200ul 200 ul
EUR 459

PIAS1 Rabbit pAb
A5729-20ul 20 ul
EUR 183

PIAS1 Rabbit pAb
A5729-50ul 50 ul
EUR 223

PIAS1 Rabbit mAb
A4744-100ul 100 ul
EUR 410

PIAS1 Rabbit mAb
A4744-200ul 200 ul
EUR 571

PIAS1 Rabbit mAb
A4744-20ul 20 ul
EUR 221

PIAS1 Rabbit mAb
A4744-50ul 50 ul
EUR 287

Anti-PIAS1 antibody
PAab06428 100 ug
EUR 412

Anti-PIAS1 Antibody
PA2252 100ug/vial
EUR 334

Anti-PIAS1 antibody
STJ28296 100 µl
EUR 277
Description: This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. This protein plays a central role as a transcriptional coregulator of numerous cellular pathways includign the STAT1 and nuclear factor kappaB pathways. Alternate splicing results in multiple transcript variants.

Anti-PIAS1 antibody
STJ114913 100 µl
EUR 277
Description: This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. This protein plays a central role as a transcriptional coregulator of numerous cellular pathways includign the STAT1 and nuclear factor kappaB pathways. Alternate splicing results in multiple transcript variants.

Anti-PIAS1 (4A4)
YF-MA16418 100 ug
EUR 363
Description: Mouse monoclonal to PIAS1

Human E3 SUMO- protein ligase PIAS1, PIAS1 ELISA KIT
ELI-21999h 96 Tests
EUR 824

Mouse E3 SUMO- protein ligase PIAS1, Pias1 ELISA KIT
ELI-15184m 96 Tests
EUR 865

PIAS1 Cell ELISA Kit
abx595479-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Mouse PIAS1 shRNA Plasmid
20-abx974796
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PIAS1 ELISA Kit
EHP0101 96Tests
EUR 521

Goat PIAS1 ELISA Kit
EGTP0101 96Tests
EUR 521

Bovine PIAS1 ELISA Kit
EBP0101 96Tests
EUR 521

Canine PIAS1 ELISA Kit
ECP0101 96Tests
EUR 521

Anserini PIAS1 ELISA Kit
EAP0101 96Tests
EUR 521

PIAS1 ELISA KIT|Human
EF001767 96 Tests
EUR 689

Porcine PIAS1 ELISA Kit
EPP0101 96Tests
EUR 521

Rat PIAS1 ELISA Kit
ERP0101 96Tests
EUR 521

Rabbit PIAS1 ELISA Kit
ERTP0101 96Tests
EUR 521

Mouse PIAS1 ELISA Kit
EMP0101 96Tests
EUR 521

Human PIAS1 shRNA Plasmid
20-abx955623
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIAS1 Recombinant Protein (Human)
RP042208 100 ug Ask for price

PIAS1 Recombinant Protein (Rat)
RP220436 100 ug Ask for price