Human Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Hu-96T 96T
EUR 647
  • Should the Human Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Mu-48T 48T
EUR 508
  • Should the Mouse Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Mu-96T 96T
EUR 661
  • Should the Mouse Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Ra-48T 48T
EUR 528
  • Should the Rat Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Ra-96T 96T
EUR 690
  • Should the Rat Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Hu-48Tests 48 Tests
EUR 522

Human Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Hu-96Tests 96 Tests
EUR 724

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Mu-48Tests 48 Tests
EUR 534

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Mu-96Tests 96 Tests
EUR 742

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Ra-48Tests 48 Tests
EUR 558

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Ra-96Tests 96 Tests
EUR 776

Human Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Hu-48Tests 48 Tests
EUR 500

Human Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Hu-96Tests 96 Tests
EUR 692

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Mu-48Tests 48 Tests
EUR 511

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Mu-96Tests 96 Tests
EUR 709

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Ra-48Tests 48 Tests
EUR 534

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Ra-96Tests 96 Tests
EUR 742

Guinea Pig ChAT ELISA Kit

EGC0756 96Tests
EUR 521

ChAT

CH23000 100 ul
EUR 179

ChAT

MO20019 100 ul
EUR 278

Chat/ Rat Chat ELISA Kit

ELI-04655r 96 Tests
EUR 886

CHAT antibody

20R-2847 100 ul
EUR 349
Description: Rabbit polyclonal CHAT antibody

CHAT antibody

70R-16378 50 ul
EUR 435
Description: Rabbit polyclonal CHAT antibody

CHAT antibody

70R-10534 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CHAT antibody

ChAT antibody

70R-10625 1 ml
EUR 693
Description: Affinity purified Chicken polyclonal ChAT antibody

CHAT antibody

70R-14948 100 ul
EUR 392
Description: Goat polyclonal CHAT antibody

CHAT Antibody

32673-100ul 100ul
EUR 252

CHAT Antibody

1-CSB-PA005314GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

CHAT Antibody

1-CSB-PA005314LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

CHAT Antibody

1-CSB-PA001637
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CHAT Antibody

DF6964 200ul
EUR 304
Description: CHAT Antibody detects endogenous levels of total CHAT.

CHAT antibody

70R-49541 100 ul
EUR 244
Description: Purified Polyclonal CHAT antibody

CHAT siRNA

20-abx911641
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHAT Antibody

ABD6964 100 ug
EUR 438

Pig Choline O-acetyltransferase (CHAT) ELISA Kit

abx361155-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Choline O-acetyltransferase (CHAT) ELISA Kit

abx516858-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CHAT Rabbit pAb

A13244-100ul 100 ul
EUR 308

CHAT Rabbit pAb

A13244-200ul 200 ul
EUR 459

CHAT Rabbit pAb

A13244-20ul 20 ul
EUR 183

CHAT Rabbit pAb

A13244-50ul 50 ul
EUR 223

CHAT Rabbit pAb

A12420-100ul 100 ul
EUR 308

CHAT Rabbit pAb

A12420-200ul 200 ul
EUR 459

CHAT Rabbit pAb

A12420-20ul 20 ul
EUR 183

CHAT Rabbit pAb

A12420-50ul 50 ul
EUR 223

CHAT Blocking Peptide

33R-8800 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHAT antibody, catalog no. 70R-10534

CHAT Blocking Peptide

DF6964-BP 1mg
EUR 195

CHAT Blocking Peptide

20-abx062416
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CHAT Conjugated Antibody

C32673 100ul
EUR 397

CHAT cloning plasmid

CSB-CL005314HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atgacagcaaaaactcccagcagtgaggagtctgggctgcccaaactgcccgtgcccccgctgcagcagaccctggccacgtacctgcagtgcatgcgacacttggtgtctgaggagcagttcaggaagagccaggccattgtgcagcagtttggggcccctggtggcctcggcg
  • Show more
Description: A cloning plasmid for the CHAT gene.

CHAT cloning plasmid

CSB-CL005314HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atggcagcaaaaactcccagcagtgaggagtctgggctgcccaaactgcccgtgcccccgctgcagcagaccctggccacgtacctgcagtgcatgcgacacttggtgtctgaggagcagttcaggaagagccaggccattgtgcagcagtttggggcccctggtggcctcggcg
  • Show more
Description: A cloning plasmid for the CHAT gene.

CHAT Rabbit mAb

A19031-100ul 100 ul
EUR 410

CHAT Rabbit mAb

A19031-200ul 200 ul
EUR 571

CHAT Rabbit mAb

A19031-20ul 20 ul
EUR 221

CHAT Rabbit mAb

A19031-50ul 50 ul
EUR 287

CHAT Rabbit pAb

A2495-100ul 100 ul
EUR 308