PML

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

DLR-PML-Hu-96T 96T
EUR 673.00
  • Should the Human Promyelocytic Leukemia Protein (PML) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Promyelocytic Leukemia Protein (PML) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

DL-PML-Hu-192 1 kit of 192 tests
EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Promyelocytic Leukemia Protein (PML)

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

DL-PML-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Promyelocytic Leukemia Protein (PML)

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

DL-PML-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Promyelocytic Leukemia Protein (PML)

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

RDR-PML-Hu-48Tests 48 Tests
EUR 544.00

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

RDR-PML-Hu-96Tests 96 Tests
EUR 756.00

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

RD-PML-Hu-48Tests 48 Tests
EUR 521.00

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

RD-PML-Hu-96Tests 96 Tests
EUR 723.00

Human Protein PML, PML ELISA KIT

ELI-36129h 96 Tests
EUR 824.00

Mouse Protein PML, Pml ELISA KIT

ELI-15331m 96 Tests
EUR 865.00

PML Antibody

1-CSB-PA003823
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PML. Recognizes PML from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

PML Antibody

CSB-PA018236KA01HU-
EUR 335.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PML. Recognizes PML from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PML Antibody

CSB-PA018236KA01HU-100ul 100ul
EUR 389.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PML. Recognizes PML from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PML antibody

10R-1742 100 ug
EUR 512.00
Description: Mouse monoclonal PML antibody

PML Antibody

32211-100ul 100ul
EUR 252.00

PML antibody

70R-30724 100 ug
EUR 327.00
Description: Rabbit polyclonal PML antibody

PML antibody

70R-50222 100 ul
EUR 244.00
Description: Purified Polyclonal PML antibody

PML antibody

70R-7965 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal PML antibody

PML siRNA

20-abx929039
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PML siRNA

20-abx929040
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PML Antibody

DF6318 200ul
EUR 304.00
Description: PML Antibody detects endogenous levels of total PML.

PML Antibody

ABD6318 100 ug
EUR 438.00

ELISA kit for Mouse Protein PML (PML)

KTE70720-48T 48T
EUR 332.00
  • Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein PML (PML)

KTE70720-5platesof96wells 5 plates of 96 wells
EUR 2115.00
  • Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein PML (PML)

KTE70720-96T 96T
EUR 539.00
  • Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PML Conjugated Antibody

C32211 100ul
EUR 397.00

PML cloning plasmid

CSB-CL018236HU-10ug 10ug
EUR 766.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2346
  • Sequence: atggagcctgcacccgcccgatctccgaggccccagcaggaccccgcccggccccaggagcccaccatgcctccccccgagaccccctctgaaggccgccagcccagccccagccccagccctacagagcgagcccccgcttcggaggaggagttccagtttctgcgctgccagc
  • Show more
Description: A cloning plasmid for the PML gene.

PML Blocking Peptide

33R-2443 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PML antibody, catalog no. 70R-7965

PML Polyclonal Antibody

41354-100ul 100ul
EUR 252.00

PML Polyclonal Antibody

41354-50ul 50ul
EUR 187.00

PML Blocking Peptide

20-abx063097
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PML / RARA Antibody

20-abx007137
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

PML Polyclonal Antibody

E-AB-32627-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM
  • Show more
Description: Rabbit antibody against Human PML for WB,IHC-p,IF,ELISA applications.

PML Polyclonal Antibody

E-AB-32627-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM
  • Show more
Description: Rabbit antibody against Human PML for WB,IHC-p,IF,ELISA applications.

PML Polyclonal Antibody

E-AB-32627-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM
  • Show more
Description: Rabbit antibody against Human PML for WB,IHC-p,IF,ELISA applications.

PML Blocking Peptide

DF6318-BP 1mg
EUR 195.00

PML Rabbit mAb

A19646-100ul 100 ul
EUR 410.00

PML Rabbit mAb

A19646-200ul 200 ul
EUR 571.00

PML Rabbit mAb

A19646-20ul 20 ul
EUR 221.00

PML Rabbit mAb

A19646-50ul 50 ul
EUR 287.00

PML Polyclonal Antibody

ABP52240-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

PML Polyclonal Antibody

ABP52240-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

PML Polyclonal Antibody

ABP52240-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

PML Polyclonal Antibody

ES3239-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against PML from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

PML Polyclonal Antibody

ES3239-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against PML from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

anti- PML antibody

FNab06572 100µg
EUR 585.00
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: promyelocytic leukemia
  • Uniprot ID: P29590
  • Gene ID: 5371
  • Research Area: Immunology, Metabolism
Description: Antibody raised against PML

Anti-PML antibody

PAab06572 100 ug
EUR 412.00

Anti-PML antibody

STJ95166 200 µl
EUR 197.00
Description: Rabbit polyclonal to PML.

Anti-PML antibody

STJ25034 100 µl
EUR 413.00
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified.

anti-PML Protein

YF-PA24405 50 ul
EUR 334.00
Description: Mouse polyclonal to PML Protein

Polyclonal PML polyclonal antibody

AMR09397G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PML polyclonal . This antibody is tested and proven to work in the following applications:

PML/RARA Polyclonal Antibody

30953-100ul 100ul
EUR 252.00

PML/RARA Polyclonal Antibody

30953-50ul 50ul
EUR 187.00

Human PML shRNA Plasmid

20-abx953606
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PML shRNA Plasmid

20-abx972115
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.