Gentaur Cz

Lékařská biotechnologická výzkumná laboratoř

PML

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
DLR-PML-Hu-96T 96T
EUR 673
  • Should the Human Promyelocytic Leukemia Protein (PML) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Promyelocytic Leukemia Protein (PML) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
RD-PML-Hu-48Tests 48 Tests
EUR 521

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
RD-PML-Hu-96Tests 96 Tests
EUR 723

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
RDR-PML-Hu-48Tests 48 Tests
EUR 544

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
RDR-PML-Hu-96Tests 96 Tests
EUR 756

Mouse Protein PML, Pml ELISA KIT
ELI-15331m 96 Tests
EUR 865

Human Protein PML, PML ELISA KIT
ELI-36129h 96 Tests
EUR 824

PML siRNA
20-abx929039
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PML siRNA
20-abx929040
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PML antibody
70R-50222 100 ul
EUR 244
Description: Purified Polyclonal PML antibody

PML antibody
70R-30724 100 ug
EUR 327
Description: Rabbit polyclonal PML antibody

PML antibody
70R-7965 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PML antibody

PML Antibody
ABD6318 100 ug
EUR 438

PML Antibody
32211-100ul 100ul
EUR 252

PML antibody
10R-1742 100 ug
EUR 512
Description: Mouse monoclonal PML antibody

PML Antibody
DF6318 200ul
EUR 304
Description: PML Antibody detects endogenous levels of total PML.

PML Antibody
1-CSB-PA003823
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PML. Recognizes PML from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

PML Antibody
CSB-PA018236KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PML. Recognizes PML from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PML Antibody
CSB-PA018236KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PML. Recognizes PML from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

ELISA kit for Mouse Protein PML (PML)
KTE70720-48T 48T
EUR 332
  • Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein PML (PML)
KTE70720-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein PML (PML)
KTE70720-96T 96T
EUR 539
  • Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PML Conjugated Antibody
C32211 100ul
EUR 397

PML cloning plasmid
CSB-CL018236HU-10ug 10ug
EUR 766
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2346
  • Sequence: atggagcctgcacccgcccgatctccgaggccccagcaggaccccgcccggccccaggagcccaccatgcctccccccgagaccccctctgaaggccgccagcccagccccagccccagccctacagagcgagcccccgcttcggaggaggagttccagtttctgcgctgccagc
  • Show more
Description: A cloning plasmid for the PML gene.

PML Polyclonal Antibody
ES3239-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PML from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

PML Polyclonal Antibody
ES3239-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PML from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

anti- PML antibody
FNab06572 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: promyelocytic leukemia
  • Uniprot ID: P29590
  • Gene ID: 5371
  • Research Area: Immunology, Metabolism
Description: Antibody raised against PML

PML Polyclonal Antibody
ABP52240-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

PML Polyclonal Antibody
ABP52240-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

PML Polyclonal Antibody
ABP52240-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

PML Blocking Peptide
20-abx063097
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PML / RARA Antibody
20-abx007137
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

PML Rabbit mAb
A19646-100ul 100 ul
EUR 410

PML Rabbit mAb
A19646-200ul 200 ul
EUR 571

PML Rabbit mAb
A19646-20ul 20 ul
EUR 221

PML Rabbit mAb
A19646-50ul 50 ul
EUR 287

PML Blocking Peptide
33R-2443 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PML antibody, catalog no. 70R-7965

PML Polyclonal Antibody
41354-100ul 100ul
EUR 252

PML Polyclonal Antibody
41354-50ul 50ul
EUR 187

PML Blocking Peptide
DF6318-BP 1mg
EUR 195

Anti-PML antibody
PAab06572 100 ug
EUR 412

Anti-PML antibody
STJ95166 200 µl
EUR 197
Description: Rabbit polyclonal to PML.

Anti-PML antibody
STJ25034 100 µl
EUR 413
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified.

anti-PML Protein
YF-PA24405 50 ul
EUR 334
Description: Mouse polyclonal to PML Protein

Polyclonal PML polyclonal antibody
AMR09397G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PML polyclonal . This antibody is tested and proven to work in the following applications:

PML ELISA KIT|Human
EF001884 96 Tests
EUR 689

Human PML shRNA Plasmid
20-abx953606
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PML/RARA Rabbit pAb
A7525-100ul 100 ul
EUR 308

PML/RARA Rabbit pAb
A7525-200ul 200 ul
EUR 459

PML/RARA Rabbit pAb
A7525-20ul 20 ul
EUR 183

PML/RARA Rabbit pAb
A7525-50ul 50 ul
EUR 223

PML/RARA Polyclonal Antibody
30953-100ul 100ul
EUR 252

PML/RARA Polyclonal Antibody
30953-50ul 50ul
EUR 187

Mouse PML shRNA Plasmid
20-abx972115
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-PML Protein Antibody
PB10084 100ug/vial
EUR 334