POLB

POLB antibody
70R-19391	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal POLB antibody

POLB Antibody
32383-100ul	SAB	100ul	EUR 252

POLB Antibody
1-CSB-PA002173	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against POLB. Recognizes POLB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

POLB Antibody
CSB-PA910465-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against POLB. Recognizes POLB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

POLB Antibody
CSB-PA910465-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against POLB. Recognizes POLB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

POLB Antibody
DF6552	Affbiotech	200ul	EUR 304
Description: POLB Antibody detects endogenous levels of total POLB.

POLB Antibody
1-CSB-PA018302GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against POLB. Recognizes POLB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

POLB Antibody
1-CSB-PA018302LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLB. Recognizes POLB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

POLB antibody
70R-5581	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal POLB antibody

POLB siRNA
20-abx904121	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POLB siRNA
20-abx929149	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POLB siRNA
20-abx929150	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POLB Antibody
ABD6552	Lifescience Market	100 ug	EUR 438

POLB Blocking Peptide
33R-3482	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POLB antibody, catalog no. 70R-5581

POLB Blocking Peptide
DF6552-BP	Affbiotech	1mg	EUR 195

POLB Conjugated Antibody
C32383	SAB	100ul	EUR 397

POLB cloning plasmid
CSB-CL018302HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1008 Sequence: ATGAGCAAACGGAAGGCGCCGCAGGAGACTCTCAACGGGGGAATCACCGACATGCTCACAGAACTCGCAAACTTTGAGAAGAACGTGAGCCAAGCTATCCACAAGTACAATGCTTACAGAAAAGCAGCATCTGTTATAGCAAAATACCCACACAAAATAAAGAGTGGAGCTGAAG Show more
Description: A cloning plasmid for the POLB gene.

POLB Polyclonal Antibody
A63170	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Anti-POLB antibody
STJ25039	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date.

POLB Antibody, HRP conjugated
1-CSB-PA018302LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLB. Recognizes POLB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

POLB Antibody, FITC conjugated
1-CSB-PA018302LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLB. Recognizes POLB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

POLB Antibody, Biotin conjugated
1-CSB-PA018302LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLB. Recognizes POLB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

POLB protein (His tag)
80R-1949	Fitzgerald	100 ug	EUR 322
Description: Recombinant human POLB protein

Mouse POLB shRNA Plasmid
20-abx972129	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat POLB shRNA Plasmid
20-abx985373	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human POLB shRNA Plasmid
20-abx953626	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

POLB Recombinant Protein (Human)
RP042337	ABM	100 ug	Ask for price

POLB Recombinant Protein (Mouse)
RP163268	ABM	100 ug	Ask for price

POLB Recombinant Protein (Rat)
RP221273	ABM	100 ug	Ask for price

POLB Polyclonal Antibody, HRP Conjugated
A63171	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

POLB Polyclonal Antibody, FITC Conjugated
A63172	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

POLB Polyclonal Antibody, Biotin Conjugated
A63173	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

[KO Validated] POLB Rabbit pAb
A1681-100ul	Abclonal	100 ul	EUR 410

[KO Validated] POLB Rabbit pAb
A1681-200ul	Abclonal	200 ul	EUR 571

[KO Validated] POLB Rabbit pAb
A1681-20ul	Abclonal	20 ul	EUR 221

[KO Validated] POLB Rabbit pAb
A1681-50ul	Abclonal	50 ul	EUR 287

Polb ORF Vector (Rat) (pORF)
ORF073759	ABM	1.0 ug DNA	EUR 506

POLB ORF Vector (Human) (pORF)
ORF014113	ABM	1.0 ug DNA	EUR 354

Polb ORF Vector (Mouse) (pORF)
ORF054424	ABM	1.0 ug DNA	EUR 506

POLB ELISA Kit (Human) (OKCD01880)
OKCD01880	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Repair polymerase that plays a key role in base-excision repair. Has 5'-deoxyribose-5-phosphate lyase (dRP lyase) activity that removes the 5' sugar phosphate and also acts as a DNA polymerase that adds one nucleotide to the 3' end of the arising single-nucleotide gap. Conducts 'gap-filling' DNA synthesis in a stepwise distributive fashion rather than in a processive fashion as for other DNA polymerases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.051 ng/mL

Polymerase DNA Directed Beta (POLb) Antibody
20-abx178070	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Polymerase DNA Directed Beta (POLB) Antibody
abx037131-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Polymerase DNA Directed Beta (POLb) Antibody
20-abx174135	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Polymerase DNA Directed Beta (POLB) Antibody
abx332418-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Polymerase DNA Directed Beta (POLB) Antibody
20-abx328340	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Polymerase DNA Directed Beta (POLB) Antibody
20-abx304879	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Polymerase DNA Directed Beta (POLB) Antibody
20-abx001412	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Polb sgRNA CRISPR Lentivector set (Rat)
K6811901	ABM	3 x 1.0 ug	EUR 339

Polb sgRNA CRISPR Lentivector set (Mouse)
K3756501	ABM	3 x 1.0 ug	EUR 339

POLB sgRNA CRISPR Lentivector set (Human)
K1680301	ABM	3 x 1.0 ug	EUR 339

Anti-DNA Polymerase beta/POLB Antibody
PB9812	BosterBio	100ug/vial	EUR 294

Mouse DNA polymerase beta, Polb ELISA KIT
ELI-09242m	Lifescience Market	96 Tests	EUR 865

Human Polymerase DNA Directed Beta (POLb) Protein
20-abx654783	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Polymerase DNA Directed Beta (POLB) Antibody (HRP)
20-abx304880	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Polymerase DNA Directed Beta (POLB) Antibody (FITC)
20-abx304881	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.