POLB

POLB Antibody
1-CSB-PA002173
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against POLB. Recognizes POLB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

POLB Antibody
1-CSB-PA018302GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against POLB. Recognizes POLB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

POLB Antibody
1-CSB-PA018302LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLB. Recognizes POLB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

POLB Antibody
32383-100ul 100ul
EUR 252.00

POLB antibody
70R-19391 50 ul
EUR 435.00
Description: Rabbit polyclonal POLB antibody

POLB antibody
70R-5581 50 ug
EUR 467.00
Description: Rabbit polyclonal POLB antibody

POLB siRNA
20-abx904121
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POLB siRNA
20-abx929149
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POLB siRNA
20-abx929150
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POLB Antibody
CSB-PA910465-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against POLB. Recognizes POLB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

POLB Antibody
CSB-PA910465-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against POLB. Recognizes POLB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

POLB Antibody
DF6552 200ul
EUR 304.00
Description: POLB Antibody detects endogenous levels of total POLB.

POLB Antibody
ABD6552 100 ug
EUR 438.00

POLB Conjugated Antibody
C32383 100ul
EUR 397.00

POLB cloning plasmid
CSB-CL018302HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: ATGAGCAAACGGAAGGCGCCGCAGGAGACTCTCAACGGGGGAATCACCGACATGCTCACAGAACTCGCAAACTTTGAGAAGAACGTGAGCCAAGCTATCCACAAGTACAATGCTTACAGAAAAGCAGCATCTGTTATAGCAAAATACCCACACAAAATAAAGAGTGGAGCTGAAG
  • Show more
Description: A cloning plasmid for the POLB gene.

POLB Blocking Peptide
33R-3482 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POLB antibody, catalog no. 70R-5581

POLB Polyclonal Antibody
A63170 100 µg
EUR 570.55
Description: The best epigenetics products

POLB Blocking Peptide
DF6552-BP 1mg
EUR 195.00

Anti-POLB antibody
STJ25039 100 µl
EUR 413.00
Description: The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date.

Rat POLB shRNA Plasmid
20-abx985373
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

POLB Antibody, HRP conjugated
1-CSB-PA018302LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLB. Recognizes POLB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

POLB Antibody, FITC conjugated
1-CSB-PA018302LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLB. Recognizes POLB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

POLB Antibody, Biotin conjugated
1-CSB-PA018302LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POLB. Recognizes POLB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human POLB shRNA Plasmid
20-abx953626
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse POLB shRNA Plasmid
20-abx972129
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

POLB protein (His tag)
80R-1949 100 ug
EUR 322.00
Description: Recombinant human POLB protein

POLB Recombinant Protein (Human)
RP042337 100 ug Ask for price

POLB Recombinant Protein (Mouse)
RP163268 100 ug Ask for price

POLB Recombinant Protein (Rat)
RP221273 100 ug Ask for price

POLB Polyclonal Antibody, HRP Conjugated
A63171 100 µg
EUR 570.55
Description: kits suitable for this type of research

POLB Polyclonal Antibody, FITC Conjugated
A63172 100 µg
EUR 570.55
Description: fast delivery possible

POLB Polyclonal Antibody, Biotin Conjugated
A63173 100 µg
EUR 570.55
Description: reagents widely cited

[KO Validated] POLB Rabbit pAb
A1681-100ul 100 ul
EUR 410.00

[KO Validated] POLB Rabbit pAb
A1681-200ul 200 ul
EUR 571.00

[KO Validated] POLB Rabbit pAb
A1681-20ul 20 ul
EUR 221.00

[KO Validated] POLB Rabbit pAb
A1681-50ul 50 ul
EUR 287.00

POLB ORF Vector (Human) (pORF)
ORF014113 1.0 ug DNA
EUR 354.00

Polb ORF Vector (Mouse) (pORF)
ORF054424 1.0 ug DNA
EUR 506.00

Polb ORF Vector (Rat) (pORF)
ORF073759 1.0 ug DNA
EUR 506.00

Polymerase DNA Directed Beta (POLB) Antibody
abx037131-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Polymerase DNA Directed Beta (POLB) Antibody
20-abx001412
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polymerase DNA Directed Beta (POLB) Antibody
abx332418-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Polymerase DNA Directed Beta (POLB) Antibody
20-abx328340
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polymerase DNA Directed Beta (POLb) Antibody
20-abx178070
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Polymerase DNA Directed Beta (POLB) Antibody
20-abx304879
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polymerase DNA Directed Beta (POLb) Antibody
20-abx174135
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

POLB sgRNA CRISPR Lentivector set (Human)
K1680301 3 x 1.0 ug
EUR 339.00

Polb sgRNA CRISPR Lentivector set (Rat)
K6811901 3 x 1.0 ug
EUR 339.00

Polb sgRNA CRISPR Lentivector set (Mouse)
K3756501 3 x 1.0 ug
EUR 339.00

Anti-DNA Polymerase beta/POLB Antibody
PB9812 100ug/vial
EUR 294.00

Human Polymerase DNA Directed Beta (POLb) Protein
20-abx654783
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Polymerase DNA Directed Beta (POLB) Antibody (HRP)
20-abx304880
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polymerase DNA Directed Beta (POLB) Antibody (FITC)
20-abx304881
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polymerase DNA Directed Beta (POLB) Antibody (Biotin)
20-abx304882
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bovine DNA polymerase beta, POLB ELISA KIT
ELI-47650b 96 Tests
EUR 928.00