Pomgnt1/ Rat Pomgnt1 ELISA Kit

ELI-05598r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POMGNT1 antibody

22230-100ul 100ul
EUR 390

POMGNT1 antibody

70R-12867 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal POMGNT1 antibody

POMGNT1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POMGNT1. Recognizes POMGNT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


PVT18668 2 ug
EUR 231

POMGNT1 Polyclonal Antibody

A60350 100 µg
EUR 570.55
Description: reagents widely cited

POMGNT1 Rabbit pAb

A9879-100ul 100 ul
EUR 308

POMGNT1 Rabbit pAb

A9879-200ul 200 ul
EUR 459

POMGNT1 Rabbit pAb

A9879-20ul 20 ul
EUR 183

POMGNT1 Rabbit pAb

A9879-50ul 50 ul
EUR 223

POMGNT1 Polyclonal Antibody

31761-100ul 100ul
EUR 252

POMGNT1 Polyclonal Antibody

31761-50ul 50ul
EUR 187

POMGNT1 cloning plasmid

CSB-CL855513HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1983
  • Sequence: atggacgactggaagcccagccccctcatcaagccctttggggctcggaagaagcggagctggtaccttacctggaagtataaactgacaaaccagcgggccctgcggagattctgtcagacaggggccgtgcttttcctgctggtgactgtcattgtcaatatcaagttgatcc
  • Show more
Description: A cloning plasmid for the POMGNT1 gene.

Anti-POMGNT1 antibody

STJ111921 100 µl
EUR 277
Description: This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described.

Anti-POMGNT1 (6C12)

YF-MA11564 100 ug
EUR 363
Description: Mouse monoclonal to POMGNT1

POMGNT1 Polyclonal Conjugated Antibody

C31761 100ul
EUR 397

Mouse POMGNT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat POMGNT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E1725h 96 Tests
EUR 824


ELA-E1725m 96 Tests
EUR 865


ELI-05596h 96 Tests
EUR 824


ELI-05597b 96 Tests
EUR 928

Mouse Pomgnt1 ELISA KIT

ELI-05599m 96 Tests
EUR 865


EF006015 96 Tests
EUR 689

Human POMGNT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

POMGNT1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POMGNT1. Recognizes POMGNT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

POMGNT1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POMGNT1. Recognizes POMGNT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

POMGNT1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POMGNT1. Recognizes POMGNT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

POMGNT1 Recombinant Protein (Human)

RP024136 100 ug Ask for price

POMGNT1 Recombinant Protein (Rat)

RP221417 100 ug Ask for price

POMGNT1 Recombinant Protein (Mouse)

RP163454 100 ug Ask for price

POMGNT1 Recombinant Protein (Mouse)

RP163457 100 ug Ask for price

POMGNT1 Polyclonal Antibody, Biotin Conjugated

A60351 100 µg
EUR 570.55
Description: Ask the seller for details

POMGNT1 Polyclonal Antibody, FITC Conjugated

A60352 100 µg
EUR 570.55
Description: The best epigenetics products

POMGNT1 Polyclonal Antibody, HRP Conjugated

A60353 100 µg
EUR 570.55
Description: kits suitable for this type of research

POMGNT1 ORF Vector (Human) (pORF)

ORF008046 1.0 ug DNA
EUR 95

Pomgnt1 ORF Vector (Rat) (pORF)

ORF073807 1.0 ug DNA
EUR 506

Pomgnt1 ORF Vector (Mouse) (pORF)

ORF054486 1.0 ug DNA
EUR 506

Pomgnt1 ORF Vector (Mouse) (pORF)

ORF054487 1.0 ug DNA
EUR 506

POMGNT1 ELISA Kit (Human) (OKEH04692)

OKEH04692 96 Wells
EUR 662
Description: Description of target: This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

POMGNT1 sgRNA CRISPR Lentivector set (Human)

K1687301 3 x 1.0 ug
EUR 339

Pomgnt1 sgRNA CRISPR Lentivector set (Mouse)

K4426101 3 x 1.0 ug
EUR 339

Pomgnt1 sgRNA CRISPR Lentivector set (Rat)

K7382601 3 x 1.0 ug
EUR 339

POMGNT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1687302 1.0 ug DNA
EUR 154

POMGNT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1687303 1.0 ug DNA
EUR 154

POMGNT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1687304 1.0 ug DNA
EUR 154

Pomgnt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4426102 1.0 ug DNA
EUR 154

Pomgnt1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4426103 1.0 ug DNA
EUR 154

Pomgnt1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4426104 1.0 ug DNA
EUR 154

Pomgnt1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7382602 1.0 ug DNA
EUR 154

Pomgnt1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7382603 1.0 ug DNA
EUR 154

Pomgnt1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7382604 1.0 ug DNA
EUR 154