POMGNT1

Pomgnt1/ Rat Pomgnt1 ELISA Kit
ELI-05598r	Lifescience Market	96 Tests	EUR 886

POMGNT1 siRNA
20-abx904133	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POMGNT1 siRNA
20-abx929250	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POMGNT1 siRNA
20-abx929251	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

POMGNT1 antibody
22230-100ul	SAB	100ul	EUR 390

POMGNT1 antibody
70R-12867	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal POMGNT1 antibody

POMGNT1 Antibody
1-CSB-PA855513LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POMGNT1. Recognizes POMGNT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

pOTB7-POMGNT1
PVT18668	Lifescience Market	2 ug	EUR 231

POMGNT1 Polyclonal Antibody
A60350	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

POMGNT1 Rabbit pAb
A9879-100ul	Abclonal	100 ul	EUR 308

POMGNT1 Rabbit pAb
A9879-200ul	Abclonal	200 ul	EUR 459

POMGNT1 Rabbit pAb
A9879-20ul	Abclonal	20 ul	EUR 183

POMGNT1 Rabbit pAb
A9879-50ul	Abclonal	50 ul	EUR 223

POMGNT1 Polyclonal Antibody
31761-100ul	SAB	100ul	EUR 252

POMGNT1 Polyclonal Antibody
31761-50ul	SAB	50ul	EUR 187

POMGNT1 cloning plasmid
CSB-CL855513HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1983 Sequence: atggacgactggaagcccagccccctcatcaagccctttggggctcggaagaagcggagctggtaccttacctggaagtataaactgacaaaccagcgggccctgcggagattctgtcagacaggggccgtgcttttcctgctggtgactgtcattgtcaatatcaagttgatcc Show more
Description: A cloning plasmid for the POMGNT1 gene.

Anti-POMGNT1 antibody
STJ111921	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described.

Anti-POMGNT1 (6C12)
YF-MA11564	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to POMGNT1

POMGNT1 Polyclonal Conjugated Antibody
C31761	SAB	100ul	EUR 397

Mouse POMGNT1 shRNA Plasmid
20-abx976564	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat POMGNT1 shRNA Plasmid
20-abx990400	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human POMGNT1 ELISA Kit
ELA-E1725h	Lifescience Market	96 Tests	EUR 824

Mouse POMGNT1 ELISA Kit
ELA-E1725m	Lifescience Market	96 Tests	EUR 865

Human POMGNT1 ELISA KIT
ELI-05596h	Lifescience Market	96 Tests	EUR 824

Bovine POMGNT1 ELISA KIT
ELI-05597b	Lifescience Market	96 Tests	EUR 928

Mouse Pomgnt1 ELISA KIT
ELI-05599m	Lifescience Market	96 Tests	EUR 865

POMGNT1 ELISA KIT|Human
EF006015	Lifescience Market	96 Tests	EUR 689

Human POMGNT1 shRNA Plasmid
20-abx960782	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

POMGNT1 Antibody, HRP conjugated
1-CSB-PA855513LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POMGNT1. Recognizes POMGNT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

POMGNT1 Antibody, FITC conjugated
1-CSB-PA855513LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POMGNT1. Recognizes POMGNT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

POMGNT1 Antibody, Biotin conjugated
1-CSB-PA855513LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POMGNT1. Recognizes POMGNT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

POMGNT1 Recombinant Protein (Human)
RP024136	ABM	100 ug	Ask for price

POMGNT1 Recombinant Protein (Rat)
RP221417	ABM	100 ug	Ask for price

POMGNT1 Recombinant Protein (Mouse)
RP163454	ABM	100 ug	Ask for price

POMGNT1 Recombinant Protein (Mouse)
RP163457	ABM	100 ug	Ask for price

POMGNT1 Polyclonal Antibody, Biotin Conjugated
A60351	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

POMGNT1 Polyclonal Antibody, FITC Conjugated
A60352	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

POMGNT1 Polyclonal Antibody, HRP Conjugated
A60353	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

POMGNT1 ORF Vector (Human) (pORF)
ORF008046	ABM	1.0 ug DNA	EUR 95

Pomgnt1 ORF Vector (Rat) (pORF)
ORF073807	ABM	1.0 ug DNA	EUR 506

Pomgnt1 ORF Vector (Mouse) (pORF)
ORF054486	ABM	1.0 ug DNA	EUR 506

Pomgnt1 ORF Vector (Mouse) (pORF)
ORF054487	ABM	1.0 ug DNA	EUR 506

POMGNT1 ELISA Kit (Human) (OKEH04692)
OKEH04692	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

POMGNT1 sgRNA CRISPR Lentivector set (Human)
K1687301	ABM	3 x 1.0 ug	EUR 339

Pomgnt1 sgRNA CRISPR Lentivector set (Mouse)
K4426101	ABM	3 x 1.0 ug	EUR 339

Pomgnt1 sgRNA CRISPR Lentivector set (Rat)
K7382601	ABM	3 x 1.0 ug	EUR 339

POMGNT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1687302	ABM	1.0 ug DNA	EUR 154

POMGNT1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1687303	ABM	1.0 ug DNA	EUR 154

POMGNT1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1687304	ABM	1.0 ug DNA	EUR 154

Pomgnt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4426102	ABM	1.0 ug DNA	EUR 154

Pomgnt1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4426103	ABM	1.0 ug DNA	EUR 154

Pomgnt1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4426104	ABM	1.0 ug DNA	EUR 154

Pomgnt1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7382602	ABM	1.0 ug DNA	EUR 154

Pomgnt1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7382603	ABM	1.0 ug DNA	EUR 154

Pomgnt1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7382604	ABM	1.0 ug DNA	EUR 154