PSD-95 Polyclonal Antibody

41365-50ul 50ul
EUR 187

Polyclonal PSD-95 Antibody

APR12997G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSD-95 . This antibody is tested and proven to work in the following applications:

PSD-95 Polyclonal Antibody

ABP54009-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human PSD-95 around the non-phosphorylation site of S295
  • Applications tips:
Description: A polyclonal antibody for detection of PSD-95 from Human, Mouse, Rat. This PSD-95 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PSD-95 around the non-phosphorylation site of S295

PSD-95 Polyclonal Antibody

ABP54009-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human PSD-95 around the non-phosphorylation site of S295
  • Applications tips:
Description: A polyclonal antibody for detection of PSD-95 from Human, Mouse, Rat. This PSD-95 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PSD-95 around the non-phosphorylation site of S295

PSD-95 Polyclonal Antibody

ABP54009-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human PSD-95 around the non-phosphorylation site of S295
  • Applications tips:
Description: A polyclonal antibody for detection of PSD-95 from Human, Mouse, Rat. This PSD-95 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PSD-95 around the non-phosphorylation site of S295

PSD-95 Polyclonal Antibody

ES5008-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PSD-95 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PSD-95 Polyclonal Antibody

ES5008-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PSD-95 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-PSD-95 antibody

STJ120204 100 µl
EUR 526

Anti-PSD-95 antibody

STJ95244 200 µl
EUR 197
Description: PSD-95 is a protein encoded by the DLG4 gene which is approximately 80,5 kDa. PSD-95 is localised to the cell membrane. It is involved in RET signalling, post NMDA receptor activation events, presynaptic function of kainate receptors, transmission across chemical synapses and developmental biology. This protein falls under the membrane-associated guanylate kinase family. It interacts with the cytoplasmic tail of NMDA receptor subunits and shaker-type potassium channels and is required for synaptic plasticity associated with NMDA receptor signalling. PSD-95 is expressed in the brain. Mutations in the DLG4 gene may result in cerebral degeneration, Huntington disease and Usher syndrome. STJ95244 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of PSD-95 protein.


MO50000 100 ul
EUR 579

PSD-95 Polyclonal Conjugated Antibody

C41365 100ul
EUR 397

DiagNano Fluorophore Labeled Gold Nanoparticles, 95 nm

GFL-95 1 mL
EUR 1053

Anti-PSD-95 Rabbit Monoclonal Antibody, Clone#RM288

M02128-1 100uL
EUR 397
Description: Anti-PSD-95 Rabbit Monoclonal Antibody, Clone#RM288 tested in WB, IHC, reactive to Human, Mouse

Custom Peptide Synthesis (>95; mass spec, hplc (mg-kg size, price based upon peptide size: 2-100 aa)

PEP-95 1 Ask for price

HBcAb Sandwich ELISA test

95 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBcAb Sandwich

PSD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSD. Recognizes PSD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

pCT-CMV-PSD95-GFP (pCMV, Dendrite Membranes, PSD-95 Tag)

CYTO117-PA-1 10 ug
EUR 684
  • Category: Bioluminescent Imaging

pCT-CMV-PSD95-GFP (pCMV, Dendrite Membranes, PSD-95 Tag)

CYTO117-VA-1 >2x10^6 IFUs
EUR 781
  • Category: Bioluminescent Imaging

Anti-PSD Antibody

A01427 100ug/vial
EUR 294

Psd/ Rat Psd ELISA Kit

ELI-45494r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA14091 50 ug
EUR 363
Description: Mouse polyclonal to PSD

Anti-PSD-93 Antibody

A04826 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for PSD-93 Antibody (DLG2) detection.tested for WB in Human.

PSD Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSD. Recognizes PSD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSD Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSD. Recognizes PSD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSD Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSD. Recognizes PSD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSD-93 Polyclonal Antibody

ABP54008-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSD-93 at AA rangle: 570-650
  • Applications tips:
Description: A polyclonal antibody for detection of PSD-93 from Human. This PSD-93 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSD-93 at AA rangle: 570-650

PSD-93 Polyclonal Antibody

ABP54008-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSD-93 at AA rangle: 570-650
  • Applications tips:
Description: A polyclonal antibody for detection of PSD-93 from Human. This PSD-93 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSD-93 at AA rangle: 570-650

PSD-93 Polyclonal Antibody

ABP54008-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSD-93 at AA rangle: 570-650
  • Applications tips:
Description: A polyclonal antibody for detection of PSD-93 from Human. This PSD-93 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSD-93 at AA rangle: 570-650

PSD-93 Polyclonal Antibody

ES5007-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PSD-93 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PSD-93 Polyclonal Antibody

ES5007-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PSD-93 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-PSD-93 antibody

STJ95243 200 µl
EUR 197
Description: Rabbit polyclonal to PSD-93.

PSD cloning plasmid

CSB-CL018842HU-10ug 10ug
EUR 790
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2430
  • Sequence: atgaaccagggggatacctggtcctccccccgggaagtctcctctcatgcccagagaatcgctagagccaaatgggaattcttctatggctccttggacccccccagctcaggtgctaagcccccagagcaggcccccccatctccacctggggtgggctcaaggcagggctctg
  • Show more
Description: A cloning plasmid for the PSD gene.

Anti-GPR87/95 Antibody

A10952 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPR87/95 Antibody (GPR87) detection.tested for IHC, WB in Human.

GPR87/95 Polyclonal Antibody

41816-100ul 100ul
EUR 252

GPR87/95 Polyclonal Antibody

41816-50ul 50ul
EUR 187

AKAP 95 Polyclonal Antibody

40564-100ul 100ul
EUR 252

AKAP 95 Polyclonal Antibody

40564-50ul 50ul
EUR 187

HIST1H2AG (Ab-95) Antibody

  • EUR 332.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against HIST1H2AG (Ab-95). Recognizes HIST1H2AG (Ab-95) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF, ChIP; Recommended dilution: IHC:1:10-1:100, IF:1:1-1:10

HIST1H2AG (Ab-95) Antibody

  • EUR 332.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against HIST1H2AG (Ab-95). Recognizes HIST1H2AG (Ab-95) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

HIST1H2AG (Ab-95) Antibody

  • EUR 332.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against HIST1H2AG (Ab-95). Recognizes HIST1H2AG (Ab-95) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

HIST1H2AG (Ab-95) Antibody

  • EUR 332.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against HIST1H2AG (Ab-95). Recognizes HIST1H2AG (Ab-95) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GPR87/95 Polyclonal Antibody

ABP53169-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human GPR87/95
  • Applications tips:
Description: A polyclonal antibody for detection of GPR87/95 from Human. This GPR87/95 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human GPR87/95

GPR87/95 Polyclonal Antibody

ABP53169-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human GPR87/95
  • Applications tips:
Description: A polyclonal antibody for detection of GPR87/95 from Human. This GPR87/95 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human GPR87/95

GPR87/95 Polyclonal Antibody

ABP53169-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human GPR87/95
  • Applications tips:
Description: A polyclonal antibody for detection of GPR87/95 from Human. This GPR87/95 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human GPR87/95

AKAP 95 Polyclonal Antibody

ABP50624-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human AKAP 95 at AA range: 300-380
  • Applications tips:
Description: A polyclonal antibody for detection of AKAP 95 from Human, Mouse, Rat. This AKAP 95 antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AKAP 95 at AA range: 300-380

AKAP 95 Polyclonal Antibody

ABP50624-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human AKAP 95 at AA range: 300-380
  • Applications tips:
Description: A polyclonal antibody for detection of AKAP 95 from Human, Mouse, Rat. This AKAP 95 antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AKAP 95 at AA range: 300-380

AKAP 95 Polyclonal Antibody

ABP50624-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human AKAP 95 at AA range: 300-380
  • Applications tips:
Description: A polyclonal antibody for detection of AKAP 95 from Human, Mouse, Rat. This AKAP 95 antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AKAP 95 at AA range: 300-380

GPR87/95 Polyclonal Antibody

ES4168-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR87/95 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

GPR87/95 Polyclonal Antibody

ES4168-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR87/95 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

AKAP 95 Polyclonal Antibody

ES1623-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AKAP 95 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

AKAP 95 Polyclonal Antibody

ES1623-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AKAP 95 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Anti-AKAP 95 antibody

STJ91533 200 µl
EUR 197
Description: Rabbit polyclonal to AKAP 95.

Anti-GPR87/95 antibody

STJ96803 200 µl
EUR 197
Description: Rabbit polyclonal to GPR87/95.