RAB1B Antibody

46179-100ul 100ul
EUR 252

RAB1B Antibody

46179-50ul 50ul
EUR 187

RAB1B Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

RAB1B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

RAB1B Antibody

DF9818 200ul
EUR 304
Description: RAB1B Antibody detects endogenous levels of total RAB1B.

RAB1B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB1B Antibody

ABD13223 100 ug
EUR 438

RAB1B Antibody

ABD9818 100 ug
EUR 438


YF-PA26677 50 ul
EUR 334
Description: Mouse polyclonal to RAB1B

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

abx027621-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

abx027621-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rab1B, Member Ras Oncogene Family (RAB1B) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

abx237001-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

abx448537-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ALP)

abx447682-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (APC)

abx447683-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (PerCP)

abx447688-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (RPE)

abx447689-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (Streptavidin)

abx447690-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B Blocking Peptide

DF9818-BP 1mg
EUR 195

RAB1B Conjugated Antibody

C46179 100ul
EUR 397

RAB1B Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB1B Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB1B Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB1B Antibody (Biotin)

abx447684-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B Antibody (FITC)

abx447685-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

RAB1B Antibody (HRP)

abx447686-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

RAB1B cloning plasmid

CSB-CL872427HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 606
  • Sequence: atgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcaggcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctacatcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatcaaact
  • Show more
Description: A cloning plasmid for the RAB1B gene.

RAB1B Rabbit pAb

A7514-100ul 100 ul
EUR 308

RAB1B Rabbit pAb

A7514-200ul 200 ul
EUR 459

RAB1B Rabbit pAb

A7514-20ul 20 ul
EUR 183

RAB1B Rabbit pAb

A7514-50ul 50 ul
EUR 223

anti- RAB1B antibody

FNab07001 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: RAB1B, member RAS oncogene family
  • Uniprot ID: Q9H0U4
  • Gene ID: 81876
  • Research Area: Signal Transduction
Description: Antibody raised against RAB1B

anti-RAB1B (1B2)

LF-MA10265 100 ug
EUR 363
Description: Mouse monoclonal to RAB1B

Anti-RAB1B antibody

PAab07001 100 ug
EUR 386

Anti-RAB1B antibody

STJ11100811 100 µl
EUR 413

Anti-Rab1b antibody

STJ140139 150 µg
EUR 408
Description: Goat polyclonal antibody to Rab1b. Rab1b belongs to the small GTPase superfamily, Rab family. Rab1b together with Rab1a control vesicle traffic from the endoplasmic reticulum to the Golgi apparatus.

Anti-Rab1b antibody

STJ140140 150 µg
EUR 408
Description: Goat polyclonal antibody to Rab1b. Rab1b belongs to the small GTPase superfamily, Rab family. Rab1b together with Rab1a control vesicle traffic from the endoplasmic reticulum to the Golgi apparatus.

Anti-RAB1B antibody

STJ29650 100 µl
EUR 277

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 390)

abx447674-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 488)

abx447675-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 565)

abx447676-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 594)

abx447677-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 633)

abx447678-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 655)

abx447679-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 680)

abx447680-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 700)

abx447681-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (PE/ATTO 594)

abx447687-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

RAB1B Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB1B Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB1B Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RAB1B protein (His tag)

80R-1589 50 ug
EUR 397
Description: Purified recombinant Human RAB1B protein


EF002219 96 Tests
EUR 689

Mouse RAB1B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB1B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB1B Recombinant Protein (Human)

RP025435 100 ug Ask for price

RAB1B Recombinant Protein (Mouse)

RP166214 100 ug Ask for price

RAB1B Recombinant Protein (Rat)

RP223265 100 ug Ask for price

Antibody for Human RAB1B

SPC-684D 0.1mg
EUR 354
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is unconjugated.

Antibody for Human RAB1B

SPC-684D-A390 0.1mg
EUR 401
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 390.

Antibody for Human RAB1B

SPC-684D-A488 0.1mg
EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 488.

Antibody for Human RAB1B

SPC-684D-A565 0.1mg
EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 565.

Antibody for Human RAB1B

SPC-684D-A594 0.1mg
EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 594.

Antibody for Human RAB1B

SPC-684D-A633 0.1mg
EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 633.

Antibody for Human RAB1B

SPC-684D-A655 0.1mg
EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 655.

Antibody for Human RAB1B

SPC-684D-A680 0.1mg
EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 680.

Antibody for Human RAB1B

SPC-684D-A700 0.1mg
EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 700.

Antibody for Human RAB1B

SPC-684D-ALP 0.1mg
EUR 394
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Alkaline Phosphatase.

Antibody for Human RAB1B

SPC-684D-APC 0.1mg
EUR 399
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to APC .

Antibody for Human RAB1B

SPC-684D-APCCY7 0.1mg
EUR 471
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to APC/Cy7.

Antibody for Human RAB1B

SPC-684D-BI 0.1mg
EUR 396
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Biotin.

Antibody for Human RAB1B

SPC-684D-DY350 0.1mg
EUR 414
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 350.

Antibody for Human RAB1B

SPC-684D-DY405 0.1mg
EUR 403
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 405.

Antibody for Human RAB1B

SPC-684D-DY488 0.1mg
EUR 393
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 488.

Antibody for Human RAB1B

SPC-684D-DY594 0.1mg
EUR 395
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 594.

Antibody for Human RAB1B

SPC-684D-DY633 0.1mg
EUR 390
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 633.

Antibody for Human RAB1B

SPC-684D-FITC 0.1mg
EUR 392
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to FITC.

Antibody for Human RAB1B

SPC-684D-HRP 0.1mg
EUR 388
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to HRP.

Antibody for Human RAB1B

SPC-684D-P594 0.1mg
EUR 407
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to PE/ATTO 594.