RAB1B

RAB1B Antibody

46179-100ul 100ul
EUR 252.00

RAB1B Antibody

46179-50ul 50ul
EUR 187.00

RAB1B Antibody

DF9818 200ul
EUR 304.00
Description: RAB1B Antibody detects endogenous levels of total RAB1B.

RAB1B Antibody

ABD9818 100 ug
EUR 438.00

RAB1B Antibody

1-CSB-PA872427LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

RAB1B Antibody

1-CSB-PA060223
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

RAB1B Antibody

1-CSB-PA019168GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAB1B antibody

70R-19690 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB1B antibody

RAB1B siRNA

20-abx930613
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB1B siRNA

20-abx930614
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RAB1B

YF-PA26677 50 ul
EUR 334.00
Description: Mouse polyclonal to RAB1B

Rab1B, Member Ras Oncogene Family (RAB1B) Antibody

20-abx114968
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

abx237001-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

20-abx218112
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

20-abx007007
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

abx027621-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

abx027621-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

abx448537-100ug 100 ug
EUR 523.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

20-abx327273
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody

20-abx301042
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ALP)

abx447682-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (APC)

abx447683-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (PerCP)

abx447688-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (RPE)

abx447689-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (Streptavidin)

abx447690-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B Rabbit pAb

A7514-100ul 100 ul
EUR 308.00

RAB1B Rabbit pAb

A7514-200ul 200 ul
EUR 459.00

RAB1B Rabbit pAb

A7514-20ul 20 ul
EUR 183.00

RAB1B Rabbit pAb

A7514-50ul 50 ul
EUR 223.00

RAB1B Blocking Peptide

DF9818-BP 1mg
EUR 195.00

RAB1B Conjugated Antibody

C46179 100ul
EUR 397.00

RAB1B cloning plasmid

CSB-CL872427HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 606
  • Sequence: atgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcaggcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctacatcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatcaaact
  • Show more
Description: A cloning plasmid for the RAB1B gene.

RAB1B Antibody (HRP)

20-abx315506
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB1B Antibody (FITC)

20-abx315507
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB1B Antibody (Biotin)

20-abx315508
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB1B Antibody (Biotin)

abx447684-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B Antibody (FITC)

abx447685-100ug 100 ug
EUR 565.00
  • Shipped within 5-12 working days.

RAB1B Antibody (HRP)

abx447686-100ug 100 ug
EUR 565.00
  • Shipped within 5-12 working days.

anti-RAB1B (1B2)

LF-MA10265 100 ug
EUR 363.00
Description: Mouse monoclonal to RAB1B

anti- RAB1B antibody

FNab07001 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: RAB1B, member RAS oncogene family
  • Uniprot ID: Q9H0U4
  • Gene ID: 81876
  • Research Area: Signal Transduction
Description: Antibody raised against RAB1B

Anti-RAB1B antibody

PAab07001 100 ug
EUR 386.00

Anti-RAB1B antibody

STJ11100811 100 µl
EUR 413.00

Anti-Rab1b antibody

STJ140139 150 µg
EUR 408.00
Description: Goat polyclonal antibody to Rab1b. Rab1b belongs to the small GTPase superfamily, Rab family. Rab1b together with Rab1a control vesicle traffic from the endoplasmic reticulum to the Golgi apparatus.

Anti-Rab1b antibody

STJ140140 150 µg
EUR 408.00
Description: Goat polyclonal antibody to Rab1b. Rab1b belongs to the small GTPase superfamily, Rab family. Rab1b together with Rab1a control vesicle traffic from the endoplasmic reticulum to the Golgi apparatus.

Anti-RAB1B antibody

STJ29650 100 µl
EUR 277.00

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 390)

abx447674-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 488)

abx447675-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 565)

abx447676-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 594)

abx447677-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 633)

abx447678-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 655)

abx447679-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 680)

abx447680-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 700)

abx447681-100ug 100 ug
EUR 578.00
  • Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (PE/ATTO 594)

abx447687-100ug 100 ug
EUR 592.00
  • Shipped within 5-12 working days.

RAB1B protein (His tag)

80R-1589 50 ug
EUR 397.00
Description: Purified recombinant Human RAB1B protein

RAB1B Antibody, HRP conjugated

1-CSB-PA872427LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB1B Antibody, FITC conjugated

1-CSB-PA872427LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB1B Antibody, Biotin conjugated

1-CSB-PA872427LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RAB1B ELISA KIT|Human

EF002219 96 Tests
EUR 689.00

Mouse RAB1B shRNA Plasmid

20-abx978590
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB1B shRNA Plasmid

20-abx963075
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Antibody for Human RAB1B

SPC-684D 0.1mg
EUR 354.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is unconjugated.

Antibody for Human RAB1B

SPC-684D-A390 0.1mg
EUR 401.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 390.

Antibody for Human RAB1B

SPC-684D-A488 0.1mg
EUR 400.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 488.

Antibody for Human RAB1B

SPC-684D-A565 0.1mg
EUR 400.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 565.

Antibody for Human RAB1B

SPC-684D-A594 0.1mg
EUR 400.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 594.

Antibody for Human RAB1B

SPC-684D-A633 0.1mg
EUR 400.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 633.

Antibody for Human RAB1B

SPC-684D-A655 0.1mg
EUR 400.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 655.

Antibody for Human RAB1B

SPC-684D-A680 0.1mg
EUR 400.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 680.

Antibody for Human RAB1B

SPC-684D-A700 0.1mg
EUR 400.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 700.

Antibody for Human RAB1B

SPC-684D-ALP 0.1mg
EUR 394.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Alkaline Phosphatase.

Antibody for Human RAB1B

SPC-684D-APC 0.1mg
EUR 399.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to APC .

Antibody for Human RAB1B

SPC-684D-APCCY7 0.1mg
EUR 471.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to APC/Cy7.

Antibody for Human RAB1B

SPC-684D-BI 0.1mg
EUR 396.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Biotin.

Antibody for Human RAB1B

SPC-684D-DY350 0.1mg
EUR 414.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 350.

Antibody for Human RAB1B

SPC-684D-DY405 0.1mg
EUR 403.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 405.

Antibody for Human RAB1B

SPC-684D-DY488 0.1mg
EUR 393.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 488.

Antibody for Human RAB1B

SPC-684D-DY594 0.1mg
EUR 395.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 594.

Antibody for Human RAB1B

SPC-684D-DY633 0.1mg
EUR 390.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 633.

Antibody for Human RAB1B

SPC-684D-FITC 0.1mg
EUR 392.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to FITC.

Antibody for Human RAB1B

SPC-684D-HRP 0.1mg
EUR 388.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to HRP.

Antibody for Human RAB1B

SPC-684D-P594 0.1mg
EUR 407.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to PE/ATTO 594.

Antibody for Human RAB1B

SPC-684D-PCP 0.1mg
EUR 399.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to PerCP.

Antibody for Human RAB1B

SPC-684D-RPE 0.1mg
EUR 397.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to RPE .

Antibody for Human RAB1B

SPC-684D-STR 0.1mg
EUR 398.00
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Streptavidin.