RAB1B

RAB1B Antibody
46179-100ul	SAB	100ul	EUR 252

RAB1B Antibody
46179-50ul	SAB	50ul	EUR 187

RAB1B Antibody
1-CSB-PA060223	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

RAB1B Antibody
1-CSB-PA872427LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

RAB1B Antibody
DF9818	Affbiotech	200ul	EUR 304
Description: RAB1B Antibody detects endogenous levels of total RAB1B.

RAB1B Antibody
1-CSB-PA019168GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAB1B siRNA
20-abx930613	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB1B siRNA
20-abx930614	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB1B Antibody
ABD13223	Lifescience Market	100 ug	EUR 438

RAB1B Antibody
ABD9818	Lifescience Market	100 ug	EUR 438

anti-RAB1B
YF-PA26677	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RAB1B

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody
20-abx007007	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody
abx027621-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody
abx027621-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody
20-abx218112	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Rab1B, Member Ras Oncogene Family (RAB1B) Antibody
20-abx114968	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody
abx237001-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody
20-abx327273	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody
abx448537-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody
20-abx301042	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ALP)
abx447682-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (APC)
abx447683-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (PerCP)
abx447688-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (RPE)
abx447689-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (Streptavidin)
abx447690-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B Blocking Peptide
DF9818-BP	Affbiotech	1mg	EUR 195

RAB1B Conjugated Antibody
C46179	SAB	100ul	EUR 397

RAB1B Antibody (HRP)
20-abx315506	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RAB1B Antibody (FITC)
20-abx315507	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RAB1B Antibody (Biotin)
20-abx315508	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RAB1B Antibody (Biotin)
abx447684-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B Antibody (FITC)
abx447685-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

RAB1B Antibody (HRP)
abx447686-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

RAB1B cloning plasmid
CSB-CL872427HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 606 Sequence: atgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcaggcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctacatcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatcaaact Show more
Description: A cloning plasmid for the RAB1B gene.

RAB1B Rabbit pAb
A7514-100ul	Abclonal	100 ul	EUR 308

RAB1B Rabbit pAb
A7514-200ul	Abclonal	200 ul	EUR 459

RAB1B Rabbit pAb
A7514-20ul	Abclonal	20 ul	EUR 183

RAB1B Rabbit pAb
A7514-50ul	Abclonal	50 ul	EUR 223

anti- RAB1B antibody
FNab07001	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: RAB1B, member RAS oncogene family Uniprot ID: Q9H0U4 Gene ID: 81876 Research Area: Signal Transduction
Description: Antibody raised against RAB1B

anti-RAB1B (1B2)
LF-MA10265	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RAB1B

Anti-RAB1B antibody
PAab07001	Lifescience Market	100 ug	EUR 386

Anti-RAB1B antibody
STJ11100811	St John's Laboratory	100 µl	EUR 413

Anti-Rab1b antibody
STJ140139	St John's Laboratory	150 µg	EUR 408
Description: Goat polyclonal antibody to Rab1b. Rab1b belongs to the small GTPase superfamily, Rab family. Rab1b together with Rab1a control vesicle traffic from the endoplasmic reticulum to the Golgi apparatus.

Anti-Rab1b antibody
STJ140140	St John's Laboratory	150 µg	EUR 408
Description: Goat polyclonal antibody to Rab1b. Rab1b belongs to the small GTPase superfamily, Rab family. Rab1b together with Rab1a control vesicle traffic from the endoplasmic reticulum to the Golgi apparatus.

Anti-RAB1B antibody
STJ29650	St John's Laboratory	100 µl	EUR 277

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 390)
abx447674-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 488)
abx447675-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 565)
abx447676-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 594)
abx447677-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 633)
abx447678-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 655)
abx447679-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 680)
abx447680-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (ATTO 700)
abx447681-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

RAB1B, Member RAS Oncogene Family (RAB1B) Antibody (PE/ATTO 594)
abx447687-100ug	Abbexa	100 ug	EUR 592
Shipped within 5-12 working days.

RAB1B Antibody, HRP conjugated
1-CSB-PA872427LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB1B Antibody, FITC conjugated
1-CSB-PA872427LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB1B Antibody, Biotin conjugated
1-CSB-PA872427LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB1B. Recognizes RAB1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RAB1B protein (His tag)
80R-1589	Fitzgerald	50 ug	EUR 397
Description: Purified recombinant Human RAB1B protein

RAB1B ELISA KIT|Human
EF002219	Lifescience Market	96 Tests	EUR 689

Mouse RAB1B shRNA Plasmid
20-abx978590	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RAB1B shRNA Plasmid
20-abx963075	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RAB1B Recombinant Protein (Human)
RP025435	ABM	100 ug	Ask for price

RAB1B Recombinant Protein (Mouse)
RP166214	ABM	100 ug	Ask for price

RAB1B Recombinant Protein (Rat)
RP223265	ABM	100 ug	Ask for price

Antibody for Human RAB1B
SPC-684D	Stressmarq	0.1mg	EUR 354
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is unconjugated.

Antibody for Human RAB1B
SPC-684D-A390	Stressmarq	0.1mg	EUR 401
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 390.

Antibody for Human RAB1B
SPC-684D-A488	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 488.

Antibody for Human RAB1B
SPC-684D-A565	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 565.

Antibody for Human RAB1B
SPC-684D-A594	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 594.

Antibody for Human RAB1B
SPC-684D-A633	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 633.

Antibody for Human RAB1B
SPC-684D-A655	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 655.

Antibody for Human RAB1B
SPC-684D-A680	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 680.

Antibody for Human RAB1B
SPC-684D-A700	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to ATTO 700.

Antibody for Human RAB1B
SPC-684D-ALP	Stressmarq	0.1mg	EUR 394
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Alkaline Phosphatase.

Antibody for Human RAB1B
SPC-684D-APC	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to APC .

Antibody for Human RAB1B
SPC-684D-APCCY7	Stressmarq	0.1mg	EUR 471
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to APC/Cy7.

Antibody for Human RAB1B
SPC-684D-BI	Stressmarq	0.1mg	EUR 396
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Biotin.

Antibody for Human RAB1B
SPC-684D-DY350	Stressmarq	0.1mg	EUR 414
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 350.

Antibody for Human RAB1B
SPC-684D-DY405	Stressmarq	0.1mg	EUR 403
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 405.

Antibody for Human RAB1B
SPC-684D-DY488	Stressmarq	0.1mg	EUR 393
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 488.

Antibody for Human RAB1B
SPC-684D-DY594	Stressmarq	0.1mg	EUR 395
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 594.

Antibody for Human RAB1B
SPC-684D-DY633	Stressmarq	0.1mg	EUR 390
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to Dylight 633.

Antibody for Human RAB1B
SPC-684D-FITC	Stressmarq	0.1mg	EUR 392
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to FITC.

Antibody for Human RAB1B
SPC-684D-HRP	Stressmarq	0.1mg	EUR 388
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to HRP.

Antibody for Human RAB1B
SPC-684D-P594	Stressmarq	0.1mg	EUR 407
Description: A polyclonal antibody for RAB1B from Human | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human RAB1B (aa. 179-189). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This RAB1B antibody is conjugated to PE/ATTO 594.