RAB3D

RAB3D Antibody
1-CSB-PA019197GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB3D. Recognizes RAB3D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB3D antibody
20R-1343 100 ug
EUR 377.00
Description: Rabbit polyclonal RAB3D antibody

RAB3D Antibody
36746-100ul 100ul
EUR 252.00

RAB3D antibody
70R-19711 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB3D antibody

RAB3D siRNA
20-abx904427
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB3D siRNA
20-abx930668
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB3D siRNA
20-abx930669
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB3D Antibody
1-CSB-PA955238
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB3D. Recognizes RAB3D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:10000, IHC:1:25-1:100

RAB3D Antibody
DF12135 200ul
EUR 304.00
Description: RAB3D antibody detects endogenous levels of RAB3D.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody
20-abx123554
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody
20-abx126450
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab3D, Member Ras Oncogene Family (RAB3D) Antibody
20-abx114992
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody
abx027281-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody
abx027281-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody
20-abx213625
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody
abx237029-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

RAB3D Conjugated Antibody
C36746 100ul
EUR 397.00

RAB3D cloning plasmid
CSB-CL019197HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: atggcatcagctggagacacccaggcaggcccacgggatgcagcagatcagaacttcgactatatgttcaaactgctactgataggcaacagcagtgtgggcaagacttccttcctgttccgatacgcggacgactccttcactcccgccttcgtcagtactgtgggcatcgattt
  • Show more
Description: A cloning plasmid for the RAB3D gene.

RAB3D Blocking Peptide
33R-4346 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB3D antibody, catalog no. 20R-1343

Human Rab3D Antibody
33308-05111 150 ug
EUR 261.00

RAB3D Polyclonal Antibody
E-AB-12253-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The RAB3D cDNA encodes a 24-kD protein as determined by in vitro translation. The deduced 219-amino acid
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat RAB3D for IHC,ELISA applications.

RAB3D Polyclonal Antibody
E-AB-12253-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The RAB3D cDNA encodes a 24-kD protein as determined by in vitro translation. The deduced 219-amino acid
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat RAB3D for IHC,ELISA applications.

RAB3D Polyclonal Antibody
E-AB-12253-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The RAB3D cDNA encodes a 24-kD protein as determined by in vitro translation. The deduced 219-amino acid
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat RAB3D for IHC,ELISA applications.

RAB3D Blocking Peptide
DF12135-BP 1mg
EUR 195.00

RAB3D Rabbit pAb
A10390-100ul 100 ul
EUR 308.00

RAB3D Rabbit pAb
A10390-200ul 200 ul
EUR 459.00

RAB3D Rabbit pAb
A10390-20ul 20 ul
EUR 183.00

RAB3D Rabbit pAb
A10390-50ul 50 ul
EUR 223.00

RAB3D Rabbit pAb
A8810-100ul 100 ul
EUR 308.00

RAB3D Rabbit pAb
A8810-200ul 200 ul
EUR 459.00

RAB3D Rabbit pAb
A8810-20ul 20 ul Ask for price

RAB3D Rabbit pAb
A8810-50ul 50 ul Ask for price

anti- RAB3D antibody
FNab07029 100µg
EUR 505.25
  • Immunogen: RAB3D, member RAS oncogene family
  • Uniprot ID: O95716
  • Gene ID: 9545
  • Research Area: Signal Transduction
Description: Antibody raised against RAB3D

Anti-RAB3D antibody
PAab07029 100 ug
EUR 355.00

pCMV-SPORT6-RAB3D
PVT13637 2 ug
EUR 391.00

Anti-RAB3D antibody
STJ111427 100 µl
EUR 277.00

Anti-RAB3D antibody
STJ112426 100 µl
EUR 277.00

anti-Anti-Rab3D
YF-PA25362 50 ul
EUR 334.00
Description: Mouse polyclonal to Anti-Rab3D

Rat RAB3D shRNA Plasmid
20-abx987510
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB3D shRNA Plasmid
20-abx956348
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAB3D shRNA Plasmid
20-abx972346
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB3D protein (His tag)
80R-1861 100 ug
EUR 305.00
Description: Purified recombinant RAB3D protein

RAB3D ELISA KIT|Human
EF002244 96 Tests
EUR 689.00

RAB3D Recombinant Protein (Human)
RP025510 100 ug Ask for price

RAB3D Recombinant Protein (Mouse)
RP166313 100 ug Ask for price

RAB3D Recombinant Protein (Rat)
RP223343 100 ug Ask for price

Polyclonal RAB3D Antibody (C-term)
APR03790G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB3D (C-term). This antibody is tested and proven to work in the following applications:

Human Rab3D Antibody (Biotin Conjugate)
33308-05121 150 ug
EUR 369.00

RAB3D ORF Vector (Human) (pORF)
ORF008504 1.0 ug DNA
EUR 95.00

Rab3d ORF Vector (Mouse) (pORF)
ORF055439 1.0 ug DNA
EUR 506.00

Rab3d ORF Vector (Rat) (pORF)
ORF074449 1.0 ug DNA
EUR 506.00

Human Rab3D AssayLite Antibody (FITC Conjugate)
33308-05141 150 ug
EUR 428.00

Human Rab3D AssayLite Antibody (RPE Conjugate)
33308-05151 150 ug
EUR 428.00

Human Rab3D AssayLite Antibody (APC Conjugate)
33308-05161 150 ug
EUR 428.00

Human Rab3D AssayLite Antibody (PerCP Conjugate)
33308-05171 150 ug
EUR 471.00

RAB3D, Member RAS Oncogene Family Protein
20-abx261384
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB3D sgRNA CRISPR Lentivector set (Human)
K1768701 3 x 1.0 ug
EUR 339.00

Rab3d sgRNA CRISPR Lentivector set (Rat)
K7036201 3 x 1.0 ug
EUR 339.00

Rab3d sgRNA CRISPR Lentivector set (Mouse)
K3841201 3 x 1.0 ug
EUR 339.00

Recombinant Human RAB3D, Member RAS Oncogene Family
7-05986 5µg Ask for price

Recombinant Human RAB3D, Member RAS Oncogene Family
7-05987 20µg Ask for price

Recombinant Human RAB3D, Member RAS Oncogene Family
7-05988 1mg Ask for price

RAB3D sgRNA CRISPR Lentivector (Human) (Target 1)
K1768702 1.0 ug DNA
EUR 154.00

RAB3D sgRNA CRISPR Lentivector (Human) (Target 2)
K1768703 1.0 ug DNA
EUR 154.00

RAB3D sgRNA CRISPR Lentivector (Human) (Target 3)
K1768704 1.0 ug DNA
EUR 154.00

Rab3d sgRNA CRISPR Lentivector (Rat) (Target 1)
K7036202 1.0 ug DNA
EUR 154.00

Rab3d sgRNA CRISPR Lentivector (Rat) (Target 2)
K7036203 1.0 ug DNA
EUR 154.00

Rab3d sgRNA CRISPR Lentivector (Rat) (Target 3)
K7036204 1.0 ug DNA
EUR 154.00

Rab3d sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3841202 1.0 ug DNA
EUR 154.00

Rab3d sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3841203 1.0 ug DNA
EUR 154.00

Rab3d sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3841204 1.0 ug DNA
EUR 154.00

RAB3D Protein Vector (Rat) (pPB-C-His)
PV297794 500 ng
EUR 603.00

RAB3D Protein Vector (Rat) (pPB-N-His)
PV297795 500 ng
EUR 603.00

RAB3D Protein Vector (Rat) (pPM-C-HA)
PV297796 500 ng
EUR 603.00

RAB3D Protein Vector (Rat) (pPM-C-His)
PV297797 500 ng
EUR 603.00

RAB3D Protein Vector (Mouse) (pPB-C-His)
PV221754 500 ng
EUR 603.00

RAB3D Protein Vector (Mouse) (pPB-N-His)
PV221755 500 ng
EUR 603.00

RAB3D Protein Vector (Mouse) (pPM-C-HA)
PV221756 500 ng
EUR 603.00

RAB3D Protein Vector (Mouse) (pPM-C-His)
PV221757 500 ng
EUR 603.00

RAB3D Protein Vector (Human) (pPB-C-His)
PV034013 500 ng
EUR 329.00

RAB3D Protein Vector (Human) (pPB-N-His)
PV034014 500 ng
EUR 329.00

RAB3D Protein Vector (Human) (pPM-C-HA)
PV034015 500 ng
EUR 329.00

RAB3D Protein Vector (Human) (pPM-C-His)
PV034016 500 ng
EUR 329.00

Recombinant Human RAB3D Protein, His, E.coli-1mg
QP13243-1mg 1mg
EUR 2757.00

Recombinant Human RAB3D Protein, His, E.coli-20ug
QP13243-20ug 20ug
EUR 201.00