RAB3D

RAB3D siRNA
20-abx904427	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB3D siRNA
20-abx930668	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB3D siRNA
20-abx930669	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB3D Antibody
36746-100ul	SAB	100ul	EUR 252

RAB3D antibody
20R-1343	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal RAB3D antibody

RAB3D antibody
70R-19711	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RAB3D antibody

RAB3D Antibody
1-CSB-PA955238	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB3D. Recognizes RAB3D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:10000, IHC:1:25-1:100

RAB3D Antibody
DF12135	Affbiotech	200ul	EUR 304
Description: RAB3D antibody detects endogenous levels of RAB3D.

RAB3D Antibody
1-CSB-PA019197GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB3D. Recognizes RAB3D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody
20-abx123554	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody
20-abx126450	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Rab3D, Member Ras Oncogene Family (RAB3D) Antibody
20-abx114992	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody
abx027281-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody
abx027281-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody
abx237029-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody
20-abx213625	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

RAB3D Conjugated Antibody
C36746	SAB	100ul	EUR 397

RAB3D cloning plasmid
CSB-CL019197HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 660 Sequence: atggcatcagctggagacacccaggcaggcccacgggatgcagcagatcagaacttcgactatatgttcaaactgctactgataggcaacagcagtgtgggcaagacttccttcctgttccgatacgcggacgactccttcactcccgccttcgtcagtactgtgggcatcgattt Show more
Description: A cloning plasmid for the RAB3D gene.

anti- RAB3D antibody
FNab07029	FN Test	100µg	EUR 505.25
Immunogen: RAB3D, member RAS oncogene family Uniprot ID: O95716 Gene ID: 9545 Research Area: Signal Transduction
Description: Antibody raised against RAB3D

RAB3D Rabbit pAb
A10390-100ul	Abclonal	100 ul	EUR 308

RAB3D Rabbit pAb
A10390-200ul	Abclonal	200 ul	EUR 459

RAB3D Rabbit pAb
A10390-20ul	Abclonal	20 ul	EUR 183

RAB3D Rabbit pAb
A10390-50ul	Abclonal	50 ul	EUR 223

RAB3D Rabbit pAb
A8810-100ul	Abclonal	100 ul	EUR 308

RAB3D Rabbit pAb
A8810-200ul	Abclonal	200 ul	EUR 459

RAB3D Rabbit pAb
A8810-20ul	Abclonal	20 ul	Ask for price

RAB3D Rabbit pAb
A8810-50ul	Abclonal	50 ul	Ask for price

RAB3D Blocking Peptide
33R-4346	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB3D antibody, catalog no. 20R-1343

Human Rab3D Antibody
33308-05111	AssayPro	150 ug	EUR 261

RAB3D Blocking Peptide
DF12135-BP	Affbiotech	1mg	EUR 195

Anti-RAB3D antibody
PAab07029	Lifescience Market	100 ug	EUR 355

pCMV-SPORT6-RAB3D
PVT13637	Lifescience Market	2 ug	EUR 391

Anti-RAB3D antibody
STJ111427	St John's Laboratory	100 µl	EUR 277

Anti-RAB3D antibody
STJ112426	St John's Laboratory	100 µl	EUR 277

anti-Anti-Rab3D
YF-PA25362	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Anti-Rab3D

Rat RAB3D shRNA Plasmid
20-abx987510	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RAB3D ELISA KIT|Human
EF002244	Lifescience Market	96 Tests	EUR 689

Human RAB3D shRNA Plasmid
20-abx956348	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RAB3D protein (His tag)
80R-1861	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant RAB3D protein

Mouse RAB3D shRNA Plasmid
20-abx972346	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RAB3D Recombinant Protein (Human)
RP025510	ABM	100 ug	Ask for price

RAB3D Recombinant Protein (Rat)
RP223343	ABM	100 ug	Ask for price

RAB3D Recombinant Protein (Mouse)
RP166313	ABM	100 ug	Ask for price

Polyclonal RAB3D Antibody (C-term)
APR03790G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB3D (C-term). This antibody is tested and proven to work in the following applications:

Human Rab3D Antibody (Biotin Conjugate)
33308-05121	AssayPro	150 ug	EUR 369

RAB3D ORF Vector (Human) (pORF)
ORF008504	ABM	1.0 ug DNA	EUR 95

Rab3d ORF Vector (Rat) (pORF)
ORF074449	ABM	1.0 ug DNA	EUR 506

Rab3d ORF Vector (Mouse) (pORF)
ORF055439	ABM	1.0 ug DNA	EUR 506

RAB3D ELISA Kit (Human) (OKCA01481)
OKCA01481	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Protein transport. Probably involved in regulated exocytosis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.12 pg/mL

RAB3D, Member RAS Oncogene Family Protein
20-abx261384	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Human Rab3D AssayLite Antibody (FITC Conjugate)
33308-05141	AssayPro	150 ug	EUR 428

Human Rab3D AssayLite Antibody (RPE Conjugate)
33308-05151	AssayPro	150 ug	EUR 428

Human Rab3D AssayLite Antibody (APC Conjugate)
33308-05161	AssayPro	150 ug	EUR 428

Human Rab3D AssayLite Antibody (PerCP Conjugate)
33308-05171	AssayPro	150 ug	EUR 471

RAB3D sgRNA CRISPR Lentivector set (Human)
K1768701	ABM	3 x 1.0 ug	EUR 339

Rab3d sgRNA CRISPR Lentivector set (Mouse)
K3841201	ABM	3 x 1.0 ug	EUR 339

Rab3d sgRNA CRISPR Lentivector set (Rat)
K7036201	ABM	3 x 1.0 ug	EUR 339

Recombinant Human RAB3D, Member RAS Oncogene Family
7-05986	CHI Scientific	5µg	Ask for price

Recombinant Human RAB3D, Member RAS Oncogene Family
7-05987	CHI Scientific	20µg	Ask for price

Recombinant Human RAB3D, Member RAS Oncogene Family
7-05988	CHI Scientific	1mg	Ask for price

RAB3D sgRNA CRISPR Lentivector (Human) (Target 1)
K1768702	ABM	1.0 ug DNA	EUR 154

RAB3D sgRNA CRISPR Lentivector (Human) (Target 2)
K1768703	ABM	1.0 ug DNA	EUR 154

RAB3D sgRNA CRISPR Lentivector (Human) (Target 3)
K1768704	ABM	1.0 ug DNA	EUR 154

Rab3d sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3841202	ABM	1.0 ug DNA	EUR 154

Rab3d sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3841203	ABM	1.0 ug DNA	EUR 154

Rab3d sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3841204	ABM	1.0 ug DNA	EUR 154

Rab3d sgRNA CRISPR Lentivector (Rat) (Target 1)
K7036202	ABM	1.0 ug DNA	EUR 154

Rab3d sgRNA CRISPR Lentivector (Rat) (Target 2)
K7036203	ABM	1.0 ug DNA	EUR 154

Rab3d sgRNA CRISPR Lentivector (Rat) (Target 3)
K7036204	ABM	1.0 ug DNA	EUR 154

Recombinant Human RAB3D Protein, His, E.coli-1mg
QP13243-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human RAB3D Protein, His, E.coli-20ug
QP13243-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human RAB3D Protein, His, E.coli-5ug
QP13243-5ug	EnQuireBio	5ug	EUR 155

RAB3D Protein Vector (Human) (pPB-C-His)
PV034013	ABM	500 ng	EUR 329

RAB3D Protein Vector (Human) (pPB-N-His)
PV034014	ABM	500 ng	EUR 329

RAB3D Protein Vector (Human) (pPM-C-HA)
PV034015	ABM	500 ng	EUR 329

RAB3D Protein Vector (Human) (pPM-C-His)
PV034016	ABM	500 ng	EUR 329

RAB3D Protein Vector (Rat) (pPB-C-His)
PV297794	ABM	500 ng	EUR 603

RAB3D Protein Vector (Rat) (pPB-N-His)
PV297795	ABM	500 ng	EUR 603

RAB3D Protein Vector (Rat) (pPM-C-HA)
PV297796	ABM	500 ng	EUR 603

RAB3D Protein Vector (Rat) (pPM-C-His)
PV297797	ABM	500 ng	EUR 603

RAB3D Protein Vector (Mouse) (pPB-C-His)
PV221754	ABM	500 ng	EUR 603

RAB3D Protein Vector (Mouse) (pPB-N-His)
PV221755	ABM	500 ng	EUR 603

RAB3D Protein Vector (Mouse) (pPM-C-HA)
PV221756	ABM	500 ng	EUR 603

RAB3D Protein Vector (Mouse) (pPM-C-His)
PV221757	ABM	500 ng	EUR 603

Rab3d 3'UTR GFP Stable Cell Line
TU167424	ABM	1.0 ml	Ask for price