  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB3D Antibody

36746-100ul 100ul
EUR 252

RAB3D antibody

20R-1343 100 ug
EUR 377
Description: Rabbit polyclonal RAB3D antibody

RAB3D antibody

70R-19711 50 ul
EUR 435
Description: Rabbit polyclonal RAB3D antibody

RAB3D Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB3D. Recognizes RAB3D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:10000, IHC:1:25-1:100

RAB3D Antibody

DF12135 200ul
EUR 304
Description: RAB3D antibody detects endogenous levels of RAB3D.

RAB3D Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB3D. Recognizes RAB3D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rab3D, Member Ras Oncogene Family (RAB3D) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody

abx027281-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody

abx027281-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody

abx237029-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RAB3D, Member RAS Oncogene Family (RAB3D) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB3D Conjugated Antibody

C36746 100ul
EUR 397

RAB3D cloning plasmid

CSB-CL019197HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: atggcatcagctggagacacccaggcaggcccacgggatgcagcagatcagaacttcgactatatgttcaaactgctactgataggcaacagcagtgtgggcaagacttccttcctgttccgatacgcggacgactccttcactcccgccttcgtcagtactgtgggcatcgattt
  • Show more
Description: A cloning plasmid for the RAB3D gene.

anti- RAB3D antibody

FNab07029 100µg
EUR 505.25
  • Immunogen: RAB3D, member RAS oncogene family
  • Uniprot ID: O95716
  • Gene ID: 9545
  • Research Area: Signal Transduction
Description: Antibody raised against RAB3D

RAB3D Rabbit pAb

A10390-100ul 100 ul
EUR 308

RAB3D Rabbit pAb

A10390-200ul 200 ul
EUR 459

RAB3D Rabbit pAb

A10390-20ul 20 ul
EUR 183

RAB3D Rabbit pAb

A10390-50ul 50 ul
EUR 223

RAB3D Rabbit pAb

A8810-100ul 100 ul
EUR 308

RAB3D Rabbit pAb

A8810-200ul 200 ul
EUR 459

RAB3D Rabbit pAb

A8810-20ul 20 ul Ask for price

RAB3D Rabbit pAb

A8810-50ul 50 ul Ask for price

RAB3D Blocking Peptide

33R-4346 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB3D antibody, catalog no. 20R-1343

Human Rab3D Antibody

33308-05111 150 ug
EUR 261

RAB3D Blocking Peptide

DF12135-BP 1mg
EUR 195

Anti-RAB3D antibody

PAab07029 100 ug
EUR 355


PVT13637 2 ug
EUR 391

Anti-RAB3D antibody

STJ111427 100 µl
EUR 277

Anti-RAB3D antibody

STJ112426 100 µl
EUR 277


YF-PA25362 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Rab3D

Rat RAB3D shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002244 96 Tests
EUR 689

Human RAB3D shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB3D protein (His tag)

80R-1861 100 ug
EUR 305
Description: Purified recombinant RAB3D protein

Mouse RAB3D shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB3D Recombinant Protein (Human)

RP025510 100 ug Ask for price

RAB3D Recombinant Protein (Rat)

RP223343 100 ug Ask for price

RAB3D Recombinant Protein (Mouse)

RP166313 100 ug Ask for price

Polyclonal RAB3D Antibody (C-term)

APR03790G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB3D (C-term). This antibody is tested and proven to work in the following applications:

Human Rab3D Antibody (Biotin Conjugate)

33308-05121 150 ug
EUR 369

RAB3D ORF Vector (Human) (pORF)

ORF008504 1.0 ug DNA
EUR 95

Rab3d ORF Vector (Rat) (pORF)

ORF074449 1.0 ug DNA
EUR 506

Rab3d ORF Vector (Mouse) (pORF)

ORF055439 1.0 ug DNA
EUR 506

RAB3D ELISA Kit (Human) (OKCA01481)

OKCA01481 96 Wells
EUR 846
Description: Description of target: Protein transport. Probably involved in regulated exocytosis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.12 pg/mL

RAB3D, Member RAS Oncogene Family Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human Rab3D AssayLite Antibody (FITC Conjugate)

33308-05141 150 ug
EUR 428

Human Rab3D AssayLite Antibody (RPE Conjugate)

33308-05151 150 ug
EUR 428

Human Rab3D AssayLite Antibody (APC Conjugate)

33308-05161 150 ug
EUR 428

Human Rab3D AssayLite Antibody (PerCP Conjugate)

33308-05171 150 ug
EUR 471

RAB3D sgRNA CRISPR Lentivector set (Human)

K1768701 3 x 1.0 ug
EUR 339

Rab3d sgRNA CRISPR Lentivector set (Mouse)

K3841201 3 x 1.0 ug
EUR 339

Rab3d sgRNA CRISPR Lentivector set (Rat)

K7036201 3 x 1.0 ug
EUR 339

Recombinant Human RAB3D, Member RAS Oncogene Family

7-05986 5µg Ask for price

Recombinant Human RAB3D, Member RAS Oncogene Family

7-05987 20µg Ask for price

Recombinant Human RAB3D, Member RAS Oncogene Family

7-05988 1mg Ask for price

RAB3D sgRNA CRISPR Lentivector (Human) (Target 1)

K1768702 1.0 ug DNA
EUR 154

RAB3D sgRNA CRISPR Lentivector (Human) (Target 2)

K1768703 1.0 ug DNA
EUR 154

RAB3D sgRNA CRISPR Lentivector (Human) (Target 3)

K1768704 1.0 ug DNA
EUR 154

Rab3d sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3841202 1.0 ug DNA
EUR 154

Rab3d sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3841203 1.0 ug DNA
EUR 154

Rab3d sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3841204 1.0 ug DNA
EUR 154

Rab3d sgRNA CRISPR Lentivector (Rat) (Target 1)

K7036202 1.0 ug DNA
EUR 154

Rab3d sgRNA CRISPR Lentivector (Rat) (Target 2)

K7036203 1.0 ug DNA
EUR 154

Rab3d sgRNA CRISPR Lentivector (Rat) (Target 3)

K7036204 1.0 ug DNA
EUR 154

Recombinant Human RAB3D Protein, His, E.coli-1mg

QP13243-1mg 1mg
EUR 2757

Recombinant Human RAB3D Protein, His, E.coli-20ug

QP13243-20ug 20ug
EUR 201

Recombinant Human RAB3D Protein, His, E.coli-5ug

QP13243-5ug 5ug
EUR 155

RAB3D Protein Vector (Human) (pPB-C-His)

PV034013 500 ng
EUR 329

RAB3D Protein Vector (Human) (pPB-N-His)

PV034014 500 ng
EUR 329

RAB3D Protein Vector (Human) (pPM-C-HA)

PV034015 500 ng
EUR 329

RAB3D Protein Vector (Human) (pPM-C-His)

PV034016 500 ng
EUR 329

RAB3D Protein Vector (Rat) (pPB-C-His)

PV297794 500 ng
EUR 603

RAB3D Protein Vector (Rat) (pPB-N-His)

PV297795 500 ng
EUR 603

RAB3D Protein Vector (Rat) (pPM-C-HA)

PV297796 500 ng
EUR 603

RAB3D Protein Vector (Rat) (pPM-C-His)

PV297797 500 ng
EUR 603

RAB3D Protein Vector (Mouse) (pPB-C-His)

PV221754 500 ng
EUR 603

RAB3D Protein Vector (Mouse) (pPB-N-His)

PV221755 500 ng
EUR 603

RAB3D Protein Vector (Mouse) (pPM-C-HA)

PV221756 500 ng
EUR 603

RAB3D Protein Vector (Mouse) (pPM-C-His)

PV221757 500 ng
EUR 603

Rab3d 3'UTR GFP Stable Cell Line

TU167424 1.0 ml Ask for price